Search for Variation by Gene:

Gene ID/Symbol/Name (e.g., LOC_Os01g08570 or hwh1 or Os01g0180900 or gly%ltransferase, note: wildcard character '%' is also acceptable.):
Upstream (kb, optional, must <= 10 kb) : Downstream (kb, optional, must <= 10 kb) :
Variations Type:

Optional: (The selected data will be displayed in the result page.)
 Show Gene Expression Atlas  Show Chromatin Accessibility Map
 Show Non-coding variation Scores

Search Results:

16 variations found. Os07g0677300/LOC_Os07g48030 (peroxidase precursor; putative; expressed), ranging from 28,678,384 bp to 28,680,073 bp (including 0 kb upstream and 0 kb downstream of the gene).

Gene IDAnnotation
LOC_Os07g48030 peroxidase precursor, putative, expressed; RAP ID: Os07g0677300; MSU ID: LOC_Os07g48030
MSU IDRAP IDSymbolNameExplanationRecommended Gene SymbolRecommended Gene Name
LOC_Os07g48030Os07g0677300POXgX9, prx112PeroxidasegX9, Peroxidase gX9, Peroxidase-gX9, class III peroxidase 112AF014470. A2YPX3, Q0D3N0. BN000641.POXGX9PEROXIDASE GX9

Gene Expression Atlas:

The expression data is from the CREP database. And the expression value is log2-transformed. Move the mouse over the cells of the heat map to get detailed tissue information and expression values.

Variation Map (with Chromatin Accessibility Map/ Non-coding Varation Scores Map) in Searched Region:

The 'big effect' variations are marked out:

ColorExplainDetails
red High impact variants defined by snpEff 'STOP_LOST', 'START_LOST', 'STOP_GAINED', 'FRAME_SHIFT' et. al., the details can be found at http://snpef f.sourceforge.net/SnpEff_manual.html#eff.
purple 'Damaging' or 'probably damaging' non-synonymous SNPs defined by PolyPhen-2 This is a qualitative result of nonsynonymous SNP annotation, where 'damaging' or 'probably damaging' means that the variant is more likely to affect protein function. Details can be found here.

Detailed Variation Information:

Var ID Chrom Position Primary Allele Secondary Allele Primary Allele Frequency DEL Frequency Var GWAS Results Effect
vg0728678515 (J) chr07 28678515 G T 50.50% 0.00% G -> T,C NA
LOC_Os07g48030.1 Alt: C| synonymous_variant LOW(snpEff)/synonymous_codon(CooVar)
LOC_Os07g48030.1 Alt: T| synonymous_variant LOW(snpEff)/synonymous_codon(CooVar)
The average chromatin accessibility score: 81.823; most accessible tissue: Callus, score: 93.885
vg0728679190 (J) chr07 28679190 T A 98.10% 0.00% T -> A NA
LOC_Os07g48030.1 Alt: A| synonymous_variant LOW(snpEff)/synonymous_codon(CooVar)
The average chromatin accessibility score: 80.935; most accessible tissue: Minghui63 flower, score: 86.453
vg0728679255 (J) chr07 28679255 C CAT 61.00% 0.19% CAT -> C NA
N Alt: DEL/silent_mutation(CooVar)
LOC_Os07g48030.1 Alt: C| splice_region_variant&intron_variant LOW(snpEff)/silent_mutation(CooVar)
LOC_Os07g48040.1 Alt: C| upstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os07g48020.1 Alt: C| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar)
The average chromatin accessibility score: 80.693; most accessible tissue: Minghui63 flower, score: 87.818
vg0728679266 (J) chr07 28679266 A G 99.70% 0.00% A -> G NA
LOC_Os07g48040.1 Alt: G| upstream_gene_variant MODIFIER(snpEff)
LOC_Os07g48020.1 Alt: G| downstream_gene_variant MODIFIER(snpEff)
LOC_Os07g48030.1 Alt: G| intron_variant MODIFIER(snpEff)
The average chromatin accessibility score: 80.602; most accessible tissue: Minghui63 flower, score: 87.888
vg0728679293 (J) chr07 28679293 A C 60.90% 0.17% C -> A
mr1039 (All); LR P-value: 8.07E-26;
mr1336 (All); LR P-value: 3.20E-09;
mr1039_2 (All); LR P-value: 2.88E-27;
mr1336_2 (All); LR P-value: 3.08E-18;
mr1632_2 (All); LR P-value: 1.18E-31
N Alt: DEL/silent_mutation(CooVar)
LOC_Os07g48040.1 Alt: A| upstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os07g48020.1 Alt: A| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os07g48030.1 Alt: A| intron_variant MODIFIER(snpEff)/silent_mutation(CooVar)
The average chromatin accessibility score: 81.315; most accessible tissue: Minghui63 flower, score: 88.293
vg0728679613 (J) chr07 28679613 T C 61.00% 0.00% C -> T
mr1039 (All); LR P-value: 6.97E-26;
mr1336 (All); LR P-value: 3.06E-09;
mr1886 (All); LR P-value: 1.74E-06;
mr1039_2 (All); LR P-value: 2.29E-27;
mr1336_2 (All); LR P-value: 3.87E-18;
mr1632_2 (All); LR P-value: 5.96E-32
LOC_Os07g48030.1 Alt: T| synonymous_variant LOW(snpEff)/synonymous_codon(CooVar)
The average chromatin accessibility score: 79.132; most accessible tissue: Zhenshan97 young leaf, score: 91.232
vg0728679648 (J) chr07 28679648 T C 60.90% 0.25% C -> T
mr1039 (All); LR P-value: 6.97E-26;
mr1336 (All); LR P-value: 3.06E-09;
mr1886 (All); LR P-value: 1.74E-06;
mr1039_2 (All); LR P-value: 2.29E-27;
mr1336_2 (All); LR P-value: 3.87E-18;
mr1632_2 (All); LR P-value: 5.96E-32
LOC_Os07g48030.1 Alt: DEL/frameshift_variant(CooVar)
LOC_Os07g48030.1 Alt: T| missense_variant MODERATE(snpEff)/nonsynonymous_codon(CooVar)/benign(PolyPhen-2)
The average chromatin accessibility score: 78.533; most accessible tissue: Zhenshan97 young leaf, score: 90.901
vg0728679732 (J) chr07 28679732 C T 99.70% 0.00% C -> T NA
LOC_Os07g48030.1 Alt: T| 3_prime_UTR_variant MODIFIER(snpEff)
LOC_Os07g48040.1 Alt: T| upstream_gene_variant MODIFIER(snpEff)
LOC_Os07g48020.1 Alt: T| downstream_gene_variant MODIFIER(snpEff)
The average chromatin accessibility score: 84.733; most accessible tissue: Zhenshan97 young leaf, score: 91.311
vg0728679741 (J) chr07 28679741 T C 60.90% 0.25% C -> T
mr1039 (All); LR P-value: 6.97E-26;
mr1336 (All); LR P-value: 3.06E-09;
mr1886 (All); LR P-value: 1.74E-06;
mr1039_2 (All); LR P-value: 2.29E-27;
mr1336_2 (All); LR P-value: 3.87E-18;
mr1632_2 (All); LR P-value: 5.96E-32
N Alt: DEL/silent_mutation(CooVar)
LOC_Os07g48030.1 Alt: T| 3_prime_UTR_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os07g48040.1 Alt: T| upstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os07g48020.1 Alt: T| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar)
The average chromatin accessibility score: 84.763; most accessible tissue: Zhenshan97 young leaf, score: 91.311
vg0728679771 (J) chr07 28679771 T A 99.40% 0.00% T -> A NA
LOC_Os07g48030.1 Alt: A| 3_prime_UTR_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os07g48040.1 Alt: A| upstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os07g48020.1 Alt: A| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar)
The average chromatin accessibility score: 83.226; most accessible tissue: Zhenshan97 young leaf, score: 90.175
vg0728679815 (J) chr07 28679815 G A 61.20% 0.23% A -> G
mr1039 (All); LR P-value: 4.74E-26;
mr1039_2 (All); LR P-value: 3.63E-27;
mr1336_2 (All); LR P-value: 4.51E-18;
mr1632_2 (All); LR P-value: 1.68E-31
N Alt: DEL/silent_mutation(CooVar)
LOC_Os07g48030.1 Alt: G| 3_prime_UTR_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os07g48040.1 Alt: G| upstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os07g48020.1 Alt: G| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar)
The average chromatin accessibility score: 81.745; most accessible tissue: Zhenshan97 young leaf, score: 88.513
vg0728679870 (J) chr07 28679870 G A 99.40% 0.00% G -> A NA
LOC_Os07g48030.1 Alt: A| 3_prime_UTR_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os07g48040.1 Alt: A| upstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os07g48020.1 Alt: A| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar)
The average chromatin accessibility score: 82.440; most accessible tissue: Zhenshan97 young leaf, score: 88.127
vg0728679906 (J) chr07 28679906 CGAGTTG CCATGCA AAGGCAT TGAGTTG CCATGCA AAGGCAT 98.70% 0.00% CGAGTTGCCA TGCAAAGGCA T -> TGAGTTGCCA TGCAAAGGCA T,C NA
LOC_Os07g48030.1 Alt: TGAGTTGCCATGCAAAGGCAT| 3_prime_UTR_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os07g48040.1 Alt: TGAGTTGCCATGCAAAGGCAT| upstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os07g48020.1 Alt: TGAGTTGCCATGCAAAGGCAT| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os07g48030.1 Alt: C| 3_prime_UTR_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os07g48040.1 Alt: C| upstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os07g48020.1 Alt: C| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar)
The average chromatin accessibility score: 83.196; most accessible tissue: Zhenshan97 panicle, score: 89.389
vg0728679937 (J) chr07 28679937 A G 60.90% 0.25% G -> A
mr1039 (All); LR P-value: 1.24E-25;
mr1336 (All); LR P-value: 3.87E-09;
mr1701 (All); LR P-value: 6.37E-13;
mr1336_2 (All); LR P-value: 2.87E-18;
mr1632_2 (All); LR P-value: 1.43E-31;
mr1915_2 (All); LR P-value: 3.43E-06
N Alt: DEL/silent_mutation(CooVar)
LOC_Os07g48030.1 Alt: A| 3_prime_UTR_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os07g48040.1 Alt: A| upstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar)
LOC_Os07g48020.1 Alt: A| downstream_gene_variant MODIFIER(snpEff)/silent_mutation(CooVar)
The average chromatin accessibility score: 82.857; most accessible tissue: Zhenshan97 panicle, score: 89.143
vg0728680072 (J) chr07 28680072 T G 99.90% 0.00% T -> G NA
LOC_Os07g48030.1 Alt: G| splice_region_variant LOW(snpEff)
LOC_Os07g48030.1 Alt: G| 3_prime_UTR_variant MODIFIER(snpEff)
LOC_Os07g48040.1 Alt: G| upstream_gene_variant MODIFIER(snpEff)
LOC_Os07g48020.1 Alt: G| downstream_gene_variant MODIFIER(snpEff)
The average chromatin accessibility score: 82.440; most accessible tissue: Zhenshan97 panicle, score: 91.693
STR0728679256 (J) chr07 28679256 ATATAT ATATATA T 61.80% 0.00% ATATATAT -> ATATAT NA