Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1227477222:

Variant ID: vg1227477222 (JBrowse)	Variation Type: INDEL
Chromosome: chr12	Position: 27477222
Reference Allele: T	Alternative Allele: TGA,TGATAG
Primary Allele: TGA	Secondary Allele: T

Inferred Ancestral Allele : TGA (evidence from allele frequency in Oryza rufipogon: TGA: 1.01, others allele: 0.00, population size: 204. )

Flanking Sequence (100 bp) in Reference Genome:

CACGTCGTGCGTGTCGGCGCAGCAGCTGTCGGGCCCCAGATGACATGACACACACATTTACTACTGTTTTTTCTTTTTCTTGTGTGAATACTACTGTAGA[T/TGA,TGATAG]
TATACAGAATATTTTCCATGTTGAGCTGCTATTGTTGCAGGCAAATCGCTGCATATGATTGATCGCTAGCTAACAGCCAAGCCAACTGACTTCATTTTGT

Reverse complement sequence

ACAAAATGAAGTCAGTTGGCTTGGCTGTTAGCTAGCGATCAATCATATGCAGCGATTTGCCTGCAACAATAGCAGCTCAACATGGAAAATATTCTGTATA[A/TCA,CTATCA]
TCTACAGTAGTATTCACACAAGAAAAAGAAAAAACAGTAGTAAATGTGTGTGTCATGTCATCTGGGGCCCGACAGCTGCTGCGCCGACACGCACGACGTG

Allele Frequencies:

Populations	Population Size	Frequency of TGA(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.30%	35.60%	0.08%	0.02%	TGATAG: 0.06%
All Indica	2759	97.50%	2.20%	0.14%	0.04%	TGATAG: 0.11%
All Japonica	1512	0.80%	99.20%	0.00%	0.00%	NA
Aus	269	98.90%	1.10%	0.00%	0.00%	NA
Indica I	595	97.60%	2.20%	0.17%	0.00%	NA
Indica II	465	97.80%	1.70%	0.00%	0.00%	TGATAG: 0.43%
Indica III	913	98.00%	2.00%	0.00%	0.00%	NA
Indica Intermediate	786	96.60%	2.80%	0.38%	0.13%	TGATAG: 0.13%
Temperate Japonica	767	0.40%	99.60%	0.00%	0.00%	NA
Tropical Japonica	504	0.80%	99.20%	0.00%	0.00%	NA
Japonica Intermediate	241	2.10%	97.90%	0.00%	0.00%	NA
VI/Aromatic	96	18.80%	81.20%	0.00%	0.00%	NA
Intermediate	90	56.70%	43.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1227477222	T -> TGATAG	LOC_Os12g44320.1	3_prime_UTR_variant ; 59.0bp to feature; MODIFIER	silent_mutation	Average:96.669; most accessible tissue: Zhenshan97 root, score: 99.146	N	N	N	N
vg1227477222	T -> TGATAG	LOC_Os12g44330.1	downstream_gene_variant ; 2893.0bp to feature; MODIFIER	silent_mutation	Average:96.669; most accessible tissue: Zhenshan97 root, score: 99.146	N	N	N	N
vg1227477222	T -> TGATAG	LOC_Os12g44330.2	downstream_gene_variant ; 4046.0bp to feature; MODIFIER	silent_mutation	Average:96.669; most accessible tissue: Zhenshan97 root, score: 99.146	N	N	N	N
vg1227477222	T -> TGA	LOC_Os12g44320.1	3_prime_UTR_variant ; 59.0bp to feature; MODIFIER	silent_mutation	Average:96.669; most accessible tissue: Zhenshan97 root, score: 99.146	N	N	N	N
vg1227477222	T -> TGA	LOC_Os12g44330.1	downstream_gene_variant ; 2893.0bp to feature; MODIFIER	silent_mutation	Average:96.669; most accessible tissue: Zhenshan97 root, score: 99.146	N	N	N	N
vg1227477222	T -> TGA	LOC_Os12g44330.2	downstream_gene_variant ; 4046.0bp to feature; MODIFIER	silent_mutation	Average:96.669; most accessible tissue: Zhenshan97 root, score: 99.146	N	N	N	N
vg1227477222	T -> DEL	N	N	silent_mutation	Average:96.669; most accessible tissue: Zhenshan97 root, score: 99.146	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1227477222	T	TGA	-0.18	0.01	0.08	-0.07	-0.03	-0.03
vg1227477222	T	TGATA*	-0.24	-0.18	0.01	-0.21	-0.15	-0.1