Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1225036212:

Variant ID: vg1225036212 (JBrowse)Variation Type: INDEL
Chromosome: chr12Position: 25036212
Reference Allele: GAlternative Allele: GCTC
Primary Allele: GSecondary Allele: GCTC

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTCCGCGTGGAACGCGTGCGCGCAGAGCGGCAGCGCGCGGAGCTCGTCGCCGTCGGCGAACTCGAGCAGGCACACGGCGCAGTCGCGCGCGGCGGTGTCG[G/GCTC]
CTCCGCCTCCCCCGCCCCCGCCGCGCGCCGCCATCGCCGACGACTTGAGGTACTGCGCCGACGGCAGCGACTTGATGGCGGCGTCGTCGAGGCCGTACGG

Reverse complement sequence

CCGTACGGCCTCGACGACGCCGCCATCAAGTCGCTGCCGTCGGCGCAGTACCTCAAGTCGTCGGCGATGGCGGCGCGCGGCGGGGGCGGGGGAGGCGGAG[C/GAGC]
CGACACCGCCGCGCGCGACTGCGCCGTGTGCCTGCTCGAGTTCGCCGACGGCGACGAGCTCCGCGCGCTGCCGCTCTGCGCGCACGCGTTCCACGCGGAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of GCTC(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.20% 0.10% 4.30% 7.43% NA
All Indica  2759 87.90% 0.10% 4.42% 7.58% NA
All Japonica  1512 86.40% 0.00% 4.76% 8.86% NA
Aus  269 98.50% 0.00% 1.12% 0.37% NA
Indica I  595 85.50% 0.00% 8.07% 6.39% NA
Indica II  465 78.90% 0.20% 6.02% 14.84% NA
Indica III  913 95.30% 0.10% 1.10% 3.50% NA
Indica Intermediate  786 86.40% 0.10% 4.58% 8.91% NA
Temperate Japonica  767 76.90% 0.00% 8.21% 14.86% NA
Tropical Japonica  504 97.60% 0.00% 0.60% 1.79% NA
Japonica Intermediate  241 92.90% 0.00% 2.49% 4.56% NA
VI/Aromatic  96 95.80% 0.00% 1.04% 3.12% NA
Intermediate  90 90.00% 0.00% 5.56% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1225036212 G -> GCTC LOC_Os12g40460.1 inframe_insertion ; p.Gly96dup; MODERATE inframe_variant Average:92.112; most accessible tissue: Zhenshan97 flag leaf, score: 98.019 N N N N
vg1225036212 G -> DEL LOC_Os12g40460.1 N frameshift_variant Average:92.112; most accessible tissue: Zhenshan97 flag leaf, score: 98.019 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1225036212 G GCTC 0.07 0.07 0.12 0.03 0.05 0.05