Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1225036195:

Variant ID: vg1225036195 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 25036195
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGCCAGACGTCGATGCAGTCCGCGTGGAACGCGTGCGCGCAGAGCGGCAGCGCGCGGAGCTCGTCGCCGTCGGCGAACTCGAGCAGGCACACGGCGCAGT[C/G]
GCGCGCGGCGGTGTCGGCTCCGCCTCCCCCGCCCCCGCCGCGCGCCGCCATCGCCGACGACTTGAGGTACTGCGCCGACGGCAGCGACTTGATGGCGGCG

Reverse complement sequence

CGCCGCCATCAAGTCGCTGCCGTCGGCGCAGTACCTCAAGTCGTCGGCGATGGCGGCGCGCGGCGGGGGCGGGGGAGGCGGAGCCGACACCGCCGCGCGC[G/C]
ACTGCGCCGTGTGCCTGCTCGAGTTCGCCGACGGCGACGAGCTCCGCGCGCTGCCGCTCTGCGCGCACGCGTTCCACGCGGACTGCATCGACGTCTGGCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.50% 5.20% 17.03% 13.25% NA
All Indica  2759 51.60% 8.00% 23.67% 16.67% NA
All Japonica  1512 82.20% 0.50% 7.74% 9.59% NA
Aus  269 89.20% 3.70% 5.58% 1.49% NA
Indica I  595 40.80% 5.50% 36.81% 16.81% NA
Indica II  465 46.20% 12.00% 22.37% 19.35% NA
Indica III  913 64.20% 5.80% 12.05% 17.96% NA
Indica Intermediate  786 48.30% 10.20% 27.99% 13.49% NA
Temperate Japonica  767 75.70% 0.30% 9.13% 14.86% NA
Tropical Japonica  504 90.10% 0.40% 5.75% 3.77% NA
Japonica Intermediate  241 86.30% 1.20% 7.47% 4.98% NA
VI/Aromatic  96 90.60% 1.00% 4.17% 4.17% NA
Intermediate  90 62.20% 5.60% 17.78% 14.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1225036195 C -> DEL LOC_Os12g40460.1 N frameshift_variant Average:92.113; most accessible tissue: Zhenshan97 flag leaf, score: 98.047 N N N N
vg1225036195 C -> G LOC_Os12g40460.1 missense_variant ; p.Asp103His; MODERATE nonsynonymous_codon ; D103H Average:92.113; most accessible tissue: Zhenshan97 flag leaf, score: 98.047 unknown unknown DELETERIOUS 0.01

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1225036195 C G -0.02 -0.02 -0.03 -0.01 -0.02 -0.02