Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1225035800:

Variant ID: vg1225035800 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 25035800
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGGATGGCCAGCGCTTGCTCCAGAAGCTGCTGCGGCCGCCGCGGTTTGGGCCGTCCGCGCCGCCGCCGCCGCCGCCGATGTTGAGGCGGTAGCGCCACGG[C/T]
GGGGACGCGGTGGAGGGGGCCTCCACGGCGAGGAGGTGGCGCTCGAAGCCGAAGGAGTAGGAGCGCTTGAGGAGGAAATCGTCTCTCGGGCCGACGTGGT

Reverse complement sequence

ACCACGTCGGCCCGAGAGACGATTTCCTCCTCAAGCGCTCCTACTCCTTCGGCTTCGAGCGCCACCTCCTCGCCGTGGAGGCCCCCTCCACCGCGTCCCC[G/A]
CCGTGGCGCTACCGCCTCAACATCGGCGGCGGCGGCGGCGGCGCGGACGGCCCAAACCGCGGCGGCCGCAGCAGCTTCTGGAGCAAGCGCTGGCCATCCC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.70%	16.10%	11.76%	19.45%	NA
All Indica	2759	59.70%	0.10%	13.45%	26.75%	NA
All Japonica	1512	32.60%	48.90%	9.06%	9.46%	NA
Aus	269	90.00%	0.00%	4.46%	5.58%	NA
Indica I	595	53.80%	0.00%	17.82%	28.40%	NA
Indica II	465	54.60%	0.20%	11.40%	33.76%	NA
Indica III	913	69.40%	0.10%	9.75%	20.70%	NA
Indica Intermediate	786	55.70%	0.30%	15.65%	28.37%	NA
Temperate Japonica	767	3.10%	84.60%	4.82%	7.43%	NA
Tropical Japonica	504	74.20%	2.80%	11.11%	11.90%	NA
Japonica Intermediate	241	39.40%	31.50%	18.26%	10.79%	NA
VI/Aromatic	96	60.40%	0.00%	27.08%	12.50%	NA
Intermediate	90	57.80%	18.90%	11.11%	12.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1225035800	C -> DEL	LOC_Os12g40460.1	N	frameshift_variant	Average:93.013; most accessible tissue: Minghui63 panicle, score: 98.135	N	N	N	N
vg1225035800	C -> T	LOC_Os12g40460.1	synonymous_variant ; p.Pro186Pro; LOW	synonymous_codon	Average:93.013; most accessible tissue: Minghui63 panicle, score: 98.135	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1225035800	C	T	0.01	0.0	0.01	0.0	0.01	0.01