Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1224819735:

Variant ID: vg1224819735 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 24819735
Reference Allele: T	Alternative Allele: G
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, G: 0.00, others allele: 0.00, population size: 309. )

Flanking Sequence (100 bp) in Reference Genome:

AACCTGAAGAAAAGATACTCGCAATGCCTTGAGCAAAAATCTCCTTTCATTGCTTATTTTGTTAACTTTGTTGGATGATAAATGCACTGATTTTCTTGTT[T/G]
TGGTTAGCAGGATGAATGCCATGTCTAGTTATCAATGACTATAACAAAGTAGTCTACATCCCACGAATCTGCACTTAGATCCTTAATCTCTTCCTTCCAG

Reverse complement sequence

CTGGAAGGAAGAGATTAAGGATCTAAGTGCAGATTCGTGGGATGTAGACTACTTTGTTATAGTCATTGATAACTAGACATGGCATTCATCCTGCTAACCA[A/C]
AACAAGAAAATCAGTGCATTTATCATCCAACAAAGTTAACAAAATAAGCAATGAAAGGAGATTTTTGCTCAAGGCATTGCGAGTATCTTTTCTTCAGGTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.90%	10.00%	0.02%	0.13%	NA
All Indica	2759	93.00%	6.80%	0.00%	0.18%	NA
All Japonica	1512	99.70%	0.30%	0.00%	0.00%	NA
Aus	269	2.60%	96.70%	0.37%	0.37%	NA
Indica I	595	77.60%	22.40%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	97.60%	2.20%	0.00%	0.22%	NA
Indica Intermediate	786	95.40%	4.20%	0.00%	0.38%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	98.30%	1.70%	0.00%	0.00%	NA
VI/Aromatic	96	89.60%	10.40%	0.00%	0.00%	NA
Intermediate	90	88.90%	11.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1224819735	T -> DEL	N	N	silent_mutation	Average:53.582; most accessible tissue: Zhenshan97 young leaf, score: 77.736	N	N	N	N
vg1224819735	T -> G	LOC_Os12g40130.1	upstream_gene_variant ; 1369.0bp to feature; MODIFIER	silent_mutation	Average:53.582; most accessible tissue: Zhenshan97 young leaf, score: 77.736	N	N	N	N
vg1224819735	T -> G	LOC_Os12g40140.1	upstream_gene_variant ; 3535.0bp to feature; MODIFIER	silent_mutation	Average:53.582; most accessible tissue: Zhenshan97 young leaf, score: 77.736	N	N	N	N
vg1224819735	T -> G	LOC_Os12g40115.1	downstream_gene_variant ; 2358.0bp to feature; MODIFIER	silent_mutation	Average:53.582; most accessible tissue: Zhenshan97 young leaf, score: 77.736	N	N	N	N
vg1224819735	T -> G	LOC_Os12g40120.1	intron_variant ; MODIFIER	silent_mutation	Average:53.582; most accessible tissue: Zhenshan97 young leaf, score: 77.736	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1224819735	NA	3.40E-10	mr1730	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224819735	NA	2.29E-10	mr1193_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224819735	NA	2.54E-06	mr1344_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224819735	NA	5.26E-08	mr1347_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224819735	NA	1.45E-16	mr1587_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224819735	NA	1.35E-08	mr1829_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251