Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1224818875:

Variant ID: vg1224818875 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 24818875
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, G: 0.03, others allele: 0.00, population size: 304. )

Flanking Sequence (100 bp) in Reference Genome:


TTATCTGTTAGCAAAATAAACAAGTAGAACATTCTTGGCTTCAATATCGTTTAAGAGTAATTCACAACATCACAATCTCAGAAGAACATTCTAAGGACAC[A/G]
CTGCAAACTTGTGCTTACTTGGATTAGTCTTGGTCTTGCCATTCAATTTCTTTGAAGTAGAGGCCTTGTGAGGAGATCCAACTAGAAATGTTGATGGTGT

Reverse complement sequence

ACACCATCAACATTTCTAGTTGGATCTCCTCACAAGGCCTCTACTTCAAAGAAATTGAATGGCAAGACCAAGACTAATCCAAGTAAGCACAAGTTTGCAG[T/C]
GTGTCCTTAGAATGTTCTTCTGAGATTGTGATGTTGTGAATTACTCTTAAACGATATTGAAGCCAAGAATGTTCTACTTGTTTATTTTGCTAACAGATAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.90% 10.00% 0.00% 0.15% NA
All Indica  2759 93.00% 6.80% 0.00% 0.18% NA
All Japonica  1512 99.70% 0.30% 0.00% 0.00% NA
Aus  269 2.60% 96.70% 0.00% 0.74% NA
Indica I  595 77.60% 22.40% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 97.60% 2.20% 0.00% 0.22% NA
Indica Intermediate  786 95.40% 4.20% 0.00% 0.38% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 1.70% 0.00% 0.00% NA
VI/Aromatic  96 89.60% 10.40% 0.00% 0.00% NA
Intermediate  90 88.90% 11.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1224818875 A -> DEL N N silent_mutation Average:48.157; most accessible tissue: Zhenshan97 young leaf, score: 70.177 N N N N
vg1224818875 A -> G LOC_Os12g40130.1 upstream_gene_variant ; 2229.0bp to feature; MODIFIER silent_mutation Average:48.157; most accessible tissue: Zhenshan97 young leaf, score: 70.177 N N N N
vg1224818875 A -> G LOC_Os12g40140.1 upstream_gene_variant ; 4395.0bp to feature; MODIFIER silent_mutation Average:48.157; most accessible tissue: Zhenshan97 young leaf, score: 70.177 N N N N
vg1224818875 A -> G LOC_Os12g40115.1 downstream_gene_variant ; 1498.0bp to feature; MODIFIER silent_mutation Average:48.157; most accessible tissue: Zhenshan97 young leaf, score: 70.177 N N N N
vg1224818875 A -> G LOC_Os12g40120.1 intron_variant ; MODIFIER silent_mutation Average:48.157; most accessible tissue: Zhenshan97 young leaf, score: 70.177 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1224818875 NA 3.40E-10 mr1730 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224818875 NA 2.29E-10 mr1193_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224818875 NA 2.54E-06 mr1344_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224818875 NA 5.26E-08 mr1347_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224818875 NA 1.45E-16 mr1587_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224818875 NA 1.35E-08 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251