Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1224818794:

Variant ID: vg1224818794 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 24818794
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.76, A: 0.23, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:

TCCTCAATCATCTCATGTTTGACATGAGAGCGGCTGCTGTTTGGATCTTCAGGCTCCTTCCCTGTTGAAAATGGATCATCTTTATCTGTTAGCAAAATAA[A/G]
CAAGTAGAACATTCTTGGCTTCAATATCGTTTAAGAGTAATTCACAACATCACAATCTCAGAAGAACATTCTAAGGACACACTGCAAACTTGTGCTTACT

Reverse complement sequence

AGTAAGCACAAGTTTGCAGTGTGTCCTTAGAATGTTCTTCTGAGATTGTGATGTTGTGAATTACTCTTAAACGATATTGAAGCCAAGAATGTTCTACTTG[T/C]
TTATTTTGCTAACAGATAAAGATGATCCATTTTCAACAGGGAAGGAGCCTGAAGATCCAAACAGCAGCCGCTCTCATGTCAAACATGAGATGATTGAGGA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.70%	10.10%	0.00%	0.15%	NA
All Indica	2759	93.00%	6.80%	0.00%	0.18%	NA
All Japonica	1512	99.70%	0.30%	0.00%	0.00%	NA
Aus	269	1.10%	98.10%	0.00%	0.74%	NA
Indica I	595	77.80%	22.20%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	97.60%	2.20%	0.00%	0.22%	NA
Indica Intermediate	786	95.30%	4.30%	0.00%	0.38%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	98.30%	1.70%	0.00%	0.00%	NA
VI/Aromatic	96	89.60%	10.40%	0.00%	0.00%	NA
Intermediate	90	84.40%	15.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1224818794	A -> DEL	N	N	silent_mutation	Average:49.327; most accessible tissue: Callus, score: 88.891	N	N	N	N
vg1224818794	A -> G	LOC_Os12g40130.1	upstream_gene_variant ; 2310.0bp to feature; MODIFIER	silent_mutation	Average:49.327; most accessible tissue: Callus, score: 88.891	N	N	N	N
vg1224818794	A -> G	LOC_Os12g40140.1	upstream_gene_variant ; 4476.0bp to feature; MODIFIER	silent_mutation	Average:49.327; most accessible tissue: Callus, score: 88.891	N	N	N	N
vg1224818794	A -> G	LOC_Os12g40115.1	downstream_gene_variant ; 1417.0bp to feature; MODIFIER	silent_mutation	Average:49.327; most accessible tissue: Callus, score: 88.891	N	N	N	N
vg1224818794	A -> G	LOC_Os12g40120.1	intron_variant ; MODIFIER	silent_mutation	Average:49.327; most accessible tissue: Callus, score: 88.891	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1224818794	NA	2.43E-06	mr1126	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224818794	NA	1.28E-15	mr1158	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224818794	NA	9.94E-10	mr1730	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224818794	NA	1.51E-10	mr1193_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224818794	NA	5.28E-06	mr1344_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224818794	NA	4.23E-17	mr1587_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1224818794	NA	1.16E-08	mr1829_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251