Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1223131002:

Variant ID: vg1223131002 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 23131002
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.91, T: 0.09, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:

GCGTTGCGTCGTCTACGGACTCAGGCGGCTCGACGACGTCCCCGACAACTCCGACGAGATGGCTTGCGACGTGGCTGGAGCTGGTGACGCCTTGCGGGCA[C/T]
CGAGTAGTGACGCTCCGGCCGGCATTCTCCTCGAGCAACTAGCCGATGAGTTCGAAGAAGATGGTAACGTCGACGAGAGCGAGCGGACGTCAGTGATGTA

Reverse complement sequence

TACATCACTGACGTCCGCTCGCTCTCGTCGACGTTACCATCTTCTTCGAACTCATCGGCTAGTTGCTCGAGGAGAATGCCGGCCGGAGCGTCACTACTCG[G/A]
TGCCCGCAAGGCGTCACCAGCTCCAGCCACGTCGCAAGCCATCTCGTCGGAGTTGTCGGGGACGTCGTCGAGCCGCCTGAGTCCGTAGACGACGCAACGC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.50%	2.40%	8.82%	36.27%	NA
All Indica	2759	24.70%	2.30%	13.88%	59.08%	NA
All Japonica	1512	97.40%	0.00%	0.20%	2.45%	NA
Aus	269	69.90%	18.20%	8.55%	3.35%	NA
Indica I	595	45.40%	1.20%	12.27%	41.18%	NA
Indica II	465	20.90%	3.00%	21.72%	54.41%	NA
Indica III	913	10.60%	1.50%	9.09%	78.75%	NA
Indica Intermediate	786	27.70%	3.70%	16.03%	52.54%	NA
Temperate Japonica	767	99.20%	0.00%	0.39%	0.39%	NA
Tropical Japonica	504	94.80%	0.00%	0.00%	5.16%	NA
Japonica Intermediate	241	96.70%	0.00%	0.00%	3.32%	NA
VI/Aromatic	96	84.40%	0.00%	2.08%	13.54%	NA
Intermediate	90	65.60%	0.00%	6.67%	27.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1223131002	C -> DEL	LOC_Os12g37680.1	N	frameshift_variant	Average:89.721; most accessible tissue: Minghui63 flag leaf, score: 99.66	N	N	N	N
vg1223131002	C -> T	LOC_Os12g37680.1	missense_variant ; p.Pro53Ser; MODERATE	nonsynonymous_codon ; P53S	Average:89.721; most accessible tissue: Minghui63 flag leaf, score: 99.66	unknown	unknown	DELETERIOUS	0.00

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1223131002	C	T	-0.03	-0.03	-0.03	-0.03	-0.03	-0.04