Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1209004589:

Variant ID: vg1209004589 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 9004589
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.81, T: 0.19, others allele: 0.00, population size: 43. )

Flanking Sequence (100 bp) in Reference Genome:

GGACGAGGCGGCCGGTCAGTGAAGACGATGATGTCCATCAGCAGCGGCGCAATATGCCAGCCGTGAAGGCGAAGAGGCTTGTCGACGGAAGATGAGGCAG[C/T]
TGGCAGTGTAGAATATGTCATTATCAGCCATGGCGATAAAGACAACATGTTTGGATAAATCCAATACACGGTATGGTAGGCGGAGCCTGCAGCTTGATTA

Reverse complement sequence

TAATCAAGCTGCAGGCTCCGCCTACCATACCGTGTATTGGATTTATCCAAACATGTTGTCTTTATCGCCATGGCTGATAATGACATATTCTACACTGCCA[G/A]
CTGCCTCATCTTCCGTCGACAAGCCTCTTCGCCTTCACGGCTGGCATATTGCGCCGCTGCTGATGGACATCATCGTCTTCACTGACCGGCCGCCTCGTCC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	39.60%	38.10%	0.34%	21.94%	NA
All Indica	2759	53.80%	10.40%	0.58%	35.19%	NA
All Japonica	1512	4.40%	94.50%	0.00%	1.06%	NA
Aus	269	81.00%	5.20%	0.00%	13.75%	NA
Indica I	595	36.30%	20.70%	0.67%	42.35%	NA
Indica II	465	51.20%	13.30%	0.43%	35.05%	NA
Indica III	913	65.30%	2.20%	0.33%	32.20%	NA
Indica Intermediate	786	55.30%	10.40%	0.89%	33.33%	NA
Temperate Japonica	767	6.00%	93.00%	0.00%	1.04%	NA
Tropical Japonica	504	3.60%	95.60%	0.00%	0.79%	NA
Japonica Intermediate	241	1.20%	97.10%	0.00%	1.66%	NA
VI/Aromatic	96	72.90%	22.90%	0.00%	4.17%	NA
Intermediate	90	36.70%	53.30%	0.00%	10.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1209004589	C -> DEL	LOC_Os12g15770.1	N	frameshift_variant	Average:46.902; most accessible tissue: Minghui63 flag leaf, score: 77.828	N	N	N	N
vg1209004589	C -> T	LOC_Os12g15770.1	missense_variant ; p.Ala17Thr; MODERATE	nonsynonymous_codon ; A17T	Average:46.902; most accessible tissue: Minghui63 flag leaf, score: 77.828	unknown	unknown	TOLERATED	0.27

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1209004589	NA	3.41E-10	mr1425	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209004589	NA	1.14E-08	mr1425	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209004589	NA	1.62E-06	mr1574	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209004589	NA	7.47E-06	mr1539_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209004589	NA	4.75E-07	mr1540_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209004589	NA	3.55E-06	mr1732_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209004589	NA	1.53E-07	mr1864_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1209004589	NA	5.59E-07	mr1882_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251