Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1206301893:

Variant ID: vg1206301893 (JBrowse)Variation Type: INDEL
Chromosome: chr12Position: 6301893
Reference Allele: GAlternative Allele: GA
Primary Allele: GSecondary Allele: GA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CATTATATGCTGTTGGTTGATTAAAAGTAAACTAATAACCAACGGCGTACAGCTTATAATCATGGCACAGTAGTAGGCGGTGGGCATGAATATTGGCCTG[G/GA]
ATTGCAGGTCGGATACGGAGTCGGAAGCAGTCCACTTTGAAGCAACACCCTCGCGGCGGAGGCCATCACCGGCGCCTCCTGCAGCGCCGCCGCCATGACG

Reverse complement sequence

CGTCATGGCGGCGGCGCTGCAGGAGGCGCCGGTGATGGCCTCCGCCGCGAGGGTGTTGCTTCAAAGTGGACTGCTTCCGACTCCGTATCCGACCTGCAAT[C/TC]
CAGGCCAATATTCATGCCCACCGCCTACTACTGTGCCATGATTATAAGCTGTACGCCGTTGGTTATTAGTTTACTTTTAATCAACCAACAGCATATAATG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of GA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.20% 5.30% 1.12% 20.42% NA
All Indica  2759 89.60% 5.00% 0.29% 5.11% NA
All Japonica  1512 51.30% 0.70% 2.58% 45.50% NA
Aus  269 19.30% 36.80% 1.49% 42.38% NA
Indica I  595 90.90% 0.80% 0.17% 8.07% NA
Indica II  465 96.30% 2.60% 0.00% 1.08% NA
Indica III  913 90.00% 7.20% 0.33% 2.41% NA
Indica Intermediate  786 84.10% 7.00% 0.51% 8.40% NA
Temperate Japonica  767 61.10% 1.00% 3.65% 34.16% NA
Tropical Japonica  504 33.50% 0.20% 1.19% 65.08% NA
Japonica Intermediate  241 56.80% 0.40% 2.07% 40.66% NA
VI/Aromatic  96 96.90% 1.00% 0.00% 2.08% NA
Intermediate  90 73.30% 2.20% 2.22% 22.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1206301893 G -> DEL LOC_Os12g11620.1 N frameshift_variant Average:69.335; most accessible tissue: Zhenshan97 flag leaf, score: 82.703 N N N N
vg1206301893 G -> GA LOC_Os12g11620.1 frameshift_variant ; p.Pro57fs; HIGH frameshift_variant Average:69.335; most accessible tissue: Zhenshan97 flag leaf, score: 82.703 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1206301893 G GA 0.06 0.0 -0.02 -0.1 -0.09 -0.12