Variant ID: vg1125246293 (JBrowse) | Variation Type: SNP |
Chromosome: chr11 | Position: 25246293 |
Reference Allele: G | Alternative Allele: T |
Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 350. )
CGGTGAAGGCTTTTTTTTACTGGATGATCATTGTTCACAGTTCATGGCGCGGATTGCTGATGCGAAGAGATCAATCTTCCATCTTCTCTTTGCTCAAGCA[G/T]
TGTTTGATTCTGCAAGCTTCAATGGCCCGAGGTGCAATGGCGGCTGCTCACATGAAACCATCGTCGGCATTGTCCAAGCAGTGTTCAAGCACCATGCGTA
TACGCATGGTGCTTGAACACTGCTTGGACAATGCCGACGATGGTTTCATGTGAGCAGCCGCCATTGCACCTCGGGCCATTGAAGCTTGCAGAATCAAACA[C/A]
TGCTTGAGCAAAGAGAAGATGGAAGATTGATCTCTTCGCATCAGCAATCCGCGCCATGAACTGTGAACAATGATCATCCAGTAAAAAAAAGCCTTCACCG
Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 94.30% | 5.70% | 0.00% | 0.00% | NA |
All Indica | 2759 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
All Japonica | 1512 | 83.00% | 17.00% | 0.00% | 0.00% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
Indica II | 465 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 71.20% | 28.80% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 98.60% | 1.40% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 88.00% | 12.00% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 91.10% | 8.90% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg1125246293 | G -> T | LOC_Os11g41990.1 | 3_prime_UTR_variant ; 48.0bp to feature; MODIFIER | silent_mutation | Average:71.989; most accessible tissue: Callus, score: 82.227 | N | N | N | N |
vg1125246293 | G -> T | LOC_Os11g41990.2 | 3_prime_UTR_variant ; 48.0bp to feature; MODIFIER | silent_mutation | Average:71.989; most accessible tissue: Callus, score: 82.227 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg1125246293 | 1.36E-08 | NA | mr1484 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1125246293 | 2.44E-06 | NA | mr1484 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1125246293 | 4.41E-11 | 1.30E-13 | mr1530 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1125246293 | 6.47E-07 | 1.08E-09 | mr1530 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1125246293 | 1.42E-10 | NA | mr1745 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1125246293 | 8.36E-07 | NA | mr1745 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1125246293 | 4.31E-06 | NA | mr1926 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1125246293 | NA | 6.78E-09 | mr1002_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1125246293 | 2.00E-07 | NA | mr1484_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1125246293 | 2.40E-11 | NA | mr1530_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/