RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg1125246255:

Variant ID: vg1125246255 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 25246255
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.02, others allele: 0.00, population size: 291. )

Flanking Sequence (100 bp) in Reference Genome:

AATTTACAATGACAGGCTTGGAGGCGACGAGAAGATGTCGGTGAAGGCTTTTTTTTACTGGATGATCATTGTTCACAGTTCATGGCGCGGATTGCTGATG[C/T]
GAAGAGATCAATCTTCCATCTTCTCTTTGCTCAAGCAGTGTTTGATTCTGCAAGCTTCAATGGCCCGAGGTGCAATGGCGGCTGCTCACATGAAACCATC

Reverse complement sequence

GATGGTTTCATGTGAGCAGCCGCCATTGCACCTCGGGCCATTGAAGCTTGCAGAATCAAACACTGCTTGAGCAAAGAGAAGATGGAAGATTGATCTCTTC[G/A]
CATCAGCAATCCGCGCCATGAACTGTGAACAATGATCATCCAGTAAAAAAAAGCCTTCACCGACATCTTCTCGTCGCCTCCAAGCCTGTCATTGTAAATT

Allele Frequencies:

Search:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.50%	9.50%	0.00%	0.00%	NA
All Indica	2759	98.30%	1.70%	0.00%	0.00%	NA
All Japonica	1512	80.70%	19.30%	0.00%	0.00%	NA
Aus	269	78.80%	21.20%	0.00%	0.00%	NA
Indica I	595	98.70%	1.30%	0.00%	0.00%	NA
Indica II	465	99.10%	0.90%	0.00%	0.00%	NA
Indica III	913	97.90%	2.10%	0.00%	0.00%	NA
Indica Intermediate	786	98.10%	1.90%	0.00%	0.00%	NA
Temperate Japonica	767	96.00%	4.00%	0.00%	0.00%	NA
Tropical Japonica	504	54.20%	45.80%	0.00%	0.00%	NA
Japonica Intermediate	241	87.60%	12.40%	0.00%	0.00%	NA
VI/Aromatic	96	54.20%	45.80%	0.00%	0.00%	NA
Intermediate	90	90.00%	10.00%	0.00%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125246255	C -> T	LOC_Os11g41990.1	3_prime_UTR_variant ; 86.0bp to feature; MODIFIER	silent_mutation	Average:72.594; most accessible tissue: Callus, score: 82.227	N	N	N	N
vg1125246255	C -> T	LOC_Os11g41990.2	3_prime_UTR_variant ; 86.0bp to feature; MODIFIER	silent_mutation	Average:72.594; most accessible tissue: Callus, score: 82.227	N	N	N	N

Showing 1 to 2 of 2 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125246255	NA	1.93E-08	mr1249	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125246255	NA	4.46E-06	mr1328	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125246255	NA	7.03E-06	mr1596	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125246255	7.02E-09	1.71E-08	mr1662	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125246255	NA	1.38E-07	mr1662	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125246255	1.10E-10	2.52E-10	mr1662_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125246255	4.48E-07	3.17E-09	mr1662_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 7 of 7 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg1125246255:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact