RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg1125246230:

Variant ID: vg1125246230 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 25246230
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 345. )

Flanking Sequence (100 bp) in Reference Genome:

GTCATGGTCCTCATGGAGTTCACCAAATTTACAATGACAGGCTTGGAGGCGACGAGAAGATGTCGGTGAAGGCTTTTTTTTACTGGATGATCATTGTTCA[C/T]
AGTTCATGGCGCGGATTGCTGATGCGAAGAGATCAATCTTCCATCTTCTCTTTGCTCAAGCAGTGTTTGATTCTGCAAGCTTCAATGGCCCGAGGTGCAA

Reverse complement sequence

TTGCACCTCGGGCCATTGAAGCTTGCAGAATCAAACACTGCTTGAGCAAAGAGAAGATGGAAGATTGATCTCTTCGCATCAGCAATCCGCGCCATGAACT[G/A]
TGAACAATGATCATCCAGTAAAAAAAAGCCTTCACCGACATCTTCTCGTCGCCTCCAAGCCTGTCATTGTAAATTTGGTGAACTCCATGAGGACCATGAC

Allele Frequencies:

Search:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	96.50%	3.40%	0.08%	0.00%	NA
All Indica	2759	95.40%	4.50%	0.07%	0.00%	NA
All Japonica	1512	98.30%	1.60%	0.07%	0.00%	NA
Aus	269	97.00%	3.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	85.20%	14.60%	0.22%	0.00%	NA
Indica III	913	99.70%	0.30%	0.00%	0.00%	NA
Indica Intermediate	786	93.10%	6.70%	0.13%	0.00%	NA
Temperate Japonica	767	99.60%	0.30%	0.13%	0.00%	NA
Tropical Japonica	504	97.20%	2.80%	0.00%	0.00%	NA
Japonica Intermediate	241	96.70%	3.30%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	96.70%	2.20%	1.11%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125246230	C -> T	LOC_Os11g41990.1	3_prime_UTR_variant ; 111.0bp to feature; MODIFIER	silent_mutation	Average:72.505; most accessible tissue: Callus, score: 82.227	N	N	N	N
vg1125246230	C -> T	LOC_Os11g41990.2	3_prime_UTR_variant ; 111.0bp to feature; MODIFIER	silent_mutation	Average:72.505; most accessible tissue: Callus, score: 82.227	N	N	N	N

Showing 1 to 2 of 2 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125246230	5.45E-16	5.25E-17	mr1238	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125246230	1.66E-10	2.67E-11	mr1309	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125246230	8.79E-07	1.11E-07	mr1484	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125246230	2.34E-08	1.08E-08	mr1841	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125246230	2.13E-12	1.40E-13	mr1238_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125246230	5.95E-12	1.26E-13	mr1484_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125246230	9.29E-14	4.18E-14	mr1841_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125246230	3.62E-08	2.67E-09	mr1900_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125246230	2.27E-08	2.27E-08	mr1945_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 9 of 9 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg1125246230:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact