RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg1125246201:

Variant ID: vg1125246201 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 25246201
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 331. )

Flanking Sequence (100 bp) in Reference Genome:

TTTCTTGCTTGTTTCTGCAAGAGAAACCAGTCATGGTCCTCATGGAGTTCACCAAATTTACAATGACAGGCTTGGAGGCGACGAGAAGATGTCGGTGAAG[G/A]
CTTTTTTTTACTGGATGATCATTGTTCACAGTTCATGGCGCGGATTGCTGATGCGAAGAGATCAATCTTCCATCTTCTCTTTGCTCAAGCAGTGTTTGAT

Reverse complement sequence

ATCAAACACTGCTTGAGCAAAGAGAAGATGGAAGATTGATCTCTTCGCATCAGCAATCCGCGCCATGAACTGTGAACAATGATCATCCAGTAAAAAAAAG[C/T]
CTTCACCGACATCTTCTCGTCGCCTCCAAGCCTGTCATTGTAAATTTGGTGAACTCCATGAGGACCATGACTGGTTTCTCTTGCAGAAACAAGCAAGAAA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	96.00%	3.40%	0.63%	0.00%	NA
All Indica	2759	95.40%	4.50%	0.11%	0.00%	NA
All Japonica	1512	97.40%	1.60%	0.99%	0.00%	NA
Aus	269	92.60%	3.00%	4.46%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	85.20%	14.60%	0.22%	0.00%	NA
Indica III	913	99.70%	0.30%	0.00%	0.00%	NA
Indica Intermediate	786	93.00%	6.70%	0.25%	0.00%	NA
Temperate Japonica	767	99.60%	0.30%	0.13%	0.00%	NA
Tropical Japonica	504	95.80%	2.80%	1.39%	0.00%	NA
Japonica Intermediate	241	93.80%	3.30%	2.90%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	96.70%	3.30%	0.00%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125246201	G -> A	LOC_Os11g41990.1	3_prime_UTR_variant ; 140.0bp to feature; MODIFIER	silent_mutation	Average:71.308; most accessible tissue: Callus, score: 82.227	N	N	N	N
vg1125246201	G -> A	LOC_Os11g41990.2	3_prime_UTR_variant ; 140.0bp to feature; MODIFIER	silent_mutation	Average:71.308; most accessible tissue: Callus, score: 82.227	N	N	N	N

Showing 1 to 2 of 2 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125246201	5.45E-16	5.25E-17	mr1238	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125246201	1.66E-10	2.67E-11	mr1309	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125246201	8.79E-07	1.11E-07	mr1484	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125246201	2.34E-08	1.08E-08	mr1841	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125246201	2.13E-12	1.40E-13	mr1238_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125246201	5.95E-12	1.26E-13	mr1484_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125246201	9.29E-14	4.18E-14	mr1841_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125246201	3.62E-08	2.67E-09	mr1900_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125246201	2.27E-08	2.27E-08	mr1945_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 9 of 9 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg1125246201:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact