| Variant ID: vg1115079352 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 15079352 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
ACAAAGCTGCCATCCAATGGGTTGTGGAGGTAATTAAATTGAGTTATTGGAGAAGATAGAGAGAAATCAGACTGGAAGACATGATTTATTTTTTTTACTA[C/G]
TGCTATTGATTTCCCAGGCATAAATTCATATTATTTTTGTATACATATATAGACGTATCCCGTATCCATGTTTTTCAGAAAATGATGTATCCTATCCATA
TATGGATAGGATACATCATTTTCTGAAAAACATGGATACGGGATACGTCTATATATGTATACAAAAATAATATGAATTTATGCCTGGGAAATCAATAGCA[G/C]
TAGTAAAAAAAATAAATCATGTCTTCCAGTCTGATTTCTCTCTATCTTCTCCAATAACTCAATTTAATTACCTCCACAACCCATTGGATGGCAGCTTTGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 29.30% | 0.40% | 31.74% | 38.55% | NA |
| All Indica | 2759 | 4.00% | 0.40% | 36.50% | 59.19% | NA |
| All Japonica | 1512 | 76.10% | 0.50% | 19.58% | 3.84% | NA |
| Aus | 269 | 1.90% | 0.00% | 59.85% | 38.29% | NA |
| Indica I | 595 | 7.20% | 0.20% | 16.47% | 76.13% | NA |
| Indica II | 465 | 1.90% | 1.10% | 55.48% | 41.51% | NA |
| Indica III | 913 | 1.60% | 0.10% | 38.66% | 59.58% | NA |
| Indica Intermediate | 786 | 5.30% | 0.40% | 37.91% | 56.36% | NA |
| Temperate Japonica | 767 | 63.00% | 0.90% | 30.25% | 5.87% | NA |
| Tropical Japonica | 504 | 95.80% | 0.00% | 2.78% | 1.39% | NA |
| Japonica Intermediate | 241 | 76.30% | 0.40% | 20.75% | 2.49% | NA |
| VI/Aromatic | 96 | 88.50% | 0.00% | 6.25% | 5.21% | NA |
| Intermediate | 90 | 41.10% | 0.00% | 33.33% | 25.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1115079352 | C -> DEL | N | N | silent_mutation | Average:10.681; most accessible tissue: Minghui63 panicle, score: 16.27 | N | N | N | N |
| vg1115079352 | C -> G | LOC_Os11g26340.1 | downstream_gene_variant ; 3386.0bp to feature; MODIFIER | silent_mutation | Average:10.681; most accessible tissue: Minghui63 panicle, score: 16.27 | N | N | N | N |
| vg1115079352 | C -> G | LOC_Os11g26360.1 | downstream_gene_variant ; 3478.0bp to feature; MODIFIER | silent_mutation | Average:10.681; most accessible tissue: Minghui63 panicle, score: 16.27 | N | N | N | N |
| vg1115079352 | C -> G | LOC_Os11g26350.1 | intron_variant ; MODIFIER | silent_mutation | Average:10.681; most accessible tissue: Minghui63 panicle, score: 16.27 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1115079352 | NA | 5.38E-07 | mr1382 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115079352 | 4.95E-06 | 4.95E-06 | mr1445 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115079352 | NA | 1.10E-06 | mr1676 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115079352 | NA | 5.51E-06 | mr1830 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115079352 | NA | 6.12E-10 | mr1905 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |