Search for Variation information by Variation ID:
Detailed information for vg1113567958:
| Variant ID: vg1113567958 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 13567958 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
Flanking Sequence (100 bp) in Reference Genome:
GACCAGGCCTTGTGCGACCTTGGAGCCAGTGTCAGCGTCATGCCAAAAGACGTCTTCGACAAGCTCAACTTCACGGTGTTGGCGCCAACACCGATGCCCC[A/T]
TCAATTGGCTAACTCGTCAGTCTGTTACCCGGCAGAGATAGCGGAGGATGTGCCAGTCAAGATACGGGATTTCTTCATCCCGGTTGACTTTGTGGTGCTG
Reverse complement sequence
CAGCACCACAAAGTCAACCGGGATGAAGAAATCCCGTATCTTGACTGGCACATCCTCCGCTATCTCTGCCGGGTAACAGACTGACGAGTTAGCCAATTGA[T/A]
GGGGCATCGGTGTTGGCGCCAACACCGTGAAGTTGAGCTTGTCGAAGACGTCTTTTGGCATGACGCTGACACTGGCTCCAAGGTCGCACAAGGCCTGGTC
Allele Frequencies:
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 57.40% | 42.40% | 0.23% | 0.00% | NA |
| All Indica | 2759 | 32.20% | 67.40% | 0.36% | 0.00% | NA |
| All Japonica | 1512 | 95.10% | 4.90% | 0.00% | 0.00% | NA |
| Aus | 269 | 87.70% | 12.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 11.40% | 88.40% | 0.17% | 0.00% | NA |
| Indica II | 465 | 57.20% | 41.90% | 0.86% | 0.00% | NA |
| Indica III | 913 | 28.30% | 71.50% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 37.80% | 61.80% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 96.30% | 3.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 91.90% | 8.10% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 64.40% | 34.40% | 1.11% | 0.00% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1113567958 | A -> T | LOC_Os11g23950.1 | missense_variant ; p.His21Leu; MODERATE | nonsynonymous_codon ; H21L | Average:32.091; most accessible tissue: Minghui63 flag leaf, score: 43.614 | probably damaging  |
-3.02 |
TOLERATED | 1.00 |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1113567958 | NA | 2.77E-10 | mr1277 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1113567958 | NA | 1.12E-08 | mr1277 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1113567958 | NA | 1.30E-11 | mr1609 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1113567958 | NA | 6.19E-06 | mr1758 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1113567958 | NA | 5.19E-07 | mr1154_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1113567958 | NA | 1.50E-06 | mr1277_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1113567958 | NA | 1.07E-09 | mr1758_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |