Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1113116839:

Variant ID: vg1113116839 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 13116839
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTCAAGTCCCGTCTTCCGCCGTCGCCGGAAACGCTCTCCCCACGCTCTCCCTCTCTCTCCACCTCCGGCCGCCGCTCCAGCCGCCATTCGCCGTCGCCCC[G/A]
GCCGTCGCCGGTCAGCGCCACCACCTCTCCGCAAAGTCGAGCTCTACCCCAGCCACCCGTTCTTTTGCGCCGAACCCCTCCAGAAGTCGCCGTCACCGTG

Reverse complement sequence

CACGGTGACGGCGACTTCTGGAGGGGTTCGGCGCAAAAGAACGGGTGGCTGGGGTAGAGCTCGACTTTGCGGAGAGGTGGTGGCGCTGACCGGCGACGGC[C/T]
GGGGCGACGGCGAATGGCGGCTGGAGCGGCGGCCGGAGGTGGAGAGAGAGGGAGAGCGTGGGGAGAGCGTTTCCGGCGACGGCGGAAGACGGGACTTGAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	73.50%	0.40%	8.02%	18.11%	NA
All Indica	2759	56.60%	0.50%	12.98%	29.90%	NA
All Japonica	1512	98.70%	0.10%	0.33%	0.79%	NA
Aus	269	94.80%	0.70%	3.35%	1.12%	NA
Indica I	595	46.20%	0.30%	12.61%	40.84%	NA
Indica II	465	47.70%	0.00%	15.27%	36.99%	NA
Indica III	913	68.30%	1.30%	11.28%	19.06%	NA
Indica Intermediate	786	56.00%	0.10%	13.87%	30.03%	NA
Temperate Japonica	767	98.70%	0.00%	0.26%	1.04%	NA
Tropical Japonica	504	98.60%	0.40%	0.60%	0.40%	NA
Japonica Intermediate	241	99.20%	0.00%	0.00%	0.83%	NA
VI/Aromatic	96	99.00%	0.00%	0.00%	1.04%	NA
Intermediate	90	75.60%	0.00%	7.78%	16.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1113116839	G -> A	LOC_Os11g22800.1	missense_variant ; p.Arg124Trp; MODERATE	nonsynonymous_codon ; R124W	Average:75.48; most accessible tissue: Minghui63 flag leaf, score: 93.546	unknown	unknown	DELETERIOUS	0.00
vg1113116839	G -> DEL	LOC_Os11g22800.1	N	frameshift_variant	Average:75.48; most accessible tissue: Minghui63 flag leaf, score: 93.546	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1113116839	G	A	-0.01	-0.01	0.0	-0.01	0.0	0.0