Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1111258312:

Variant ID: vg1111258312 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 11258312
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.72, T: 0.29, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:


AAATCATTCTTCAAGATCAGGATGCACATCAGTCTTGCCATCTGCAGGAAGAGGGAAAGCAGAAGAGCCAGGCATGGCTTGTGACTGTGGAGAAGCAAGC[C/T]
AAGCAGTCGGTGGCAGTGAGAACCAGAGACCTCCATATGGATACGGCGCTGCCTGCGGCGTCGGAACAGCGAGAGGACCAGTAGATCTCACAACGATCTG

Reverse complement sequence

CAGATCGTTGTGAGATCTACTGGTCCTCTCGCTGTTCCGACGCCGCAGGCAGCGCCGTATCCATATGGAGGTCTCTGGTTCTCACTGCCACCGACTGCTT[G/A]
GCTTGCTTCTCCACAGTCACAAGCCATGCCTGGCTCTTCTGCTTTCCCTCTTCCTGCAGATGGCAAGACTGATGTGCATCCTGATCTTGAAGAATGATTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.40% 34.10% 0.23% 10.30% NA
All Indica  2759 80.80% 2.10% 0.25% 16.82% NA
All Japonica  1512 4.00% 95.00% 0.07% 0.86% NA
Aus  269 99.60% 0.00% 0.37% 0.00% NA
Indica I  595 73.90% 2.50% 0.17% 23.36% NA
Indica II  465 99.10% 0.20% 0.22% 0.43% NA
Indica III  913 74.30% 0.50% 0.11% 25.08% NA
Indica Intermediate  786 82.80% 4.70% 0.51% 11.96% NA
Temperate Japonica  767 2.60% 96.60% 0.00% 0.78% NA
Tropical Japonica  504 7.50% 91.50% 0.20% 0.79% NA
Japonica Intermediate  241 1.20% 97.50% 0.00% 1.24% NA
VI/Aromatic  96 14.60% 85.40% 0.00% 0.00% NA
Intermediate  90 48.90% 37.80% 2.22% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1111258312 C -> T LOC_Os11g19530.1 stop_gained ; p.Trp47*; HIGH stop_gained Average:74.565; most accessible tissue: Zhenshan97 panicle, score: 89.389 N N N N
vg1111258312 C -> DEL LOC_Os11g19530.1 N frameshift_variant Average:74.565; most accessible tissue: Zhenshan97 panicle, score: 89.389 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1111258312 C T -0.01 -0.01 -0.02 -0.02 -0.02 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1111258312 NA 3.82E-19 Yield All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1111258312 NA 1.42E-09 mr1302 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111258312 NA 2.55E-14 mr1361 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111258312 NA 4.86E-14 mr1376 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111258312 NA 1.64E-23 mr1383 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111258312 NA 9.75E-07 mr1392 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111258312 NA 4.86E-14 mr1431 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111258312 NA 1.82E-07 mr1604 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111258312 NA 2.38E-13 mr1636 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111258312 NA 1.04E-12 mr1641 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111258312 NA 3.90E-11 mr1683 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111258312 NA 2.72E-27 mr1723 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111258312 NA 6.29E-86 mr1758 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111258312 NA 9.75E-09 mr1776 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111258312 NA 1.22E-07 mr1779 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111258312 NA 2.85E-07 mr1810 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111258312 NA 4.03E-24 mr1839 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111258312 NA 1.42E-06 mr1886 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251