RiceVarMap2

Detailed information for vg1105974446:

Variant ID: vg1105974446 (JBrowse)

Variation Type: SNP

Chromosome: chr11

Position: 5974446

Reference Allele: T

Alternative Allele: G,C

Primary Allele: T

Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CGGCAGCTCGGTGACGGCGAAGGGCCGCATCGACATGGACGCCGGGGAGCGCGAGTCGGTGGTGATCGGCGGCACGGGGCGGTTTCGGCTCGCGCGCGGG[T/G,C]
ACATGGTCACCAAGAACTACGACTACAGCCTCGCCACCGGCGGCGTCGTCCAGATCGACGTCTGCCTGCAGCACTAGCTAGCCATGGACAGAAAACGCAC

Reverse complement sequence

GTGCGTTTTCTGTCCATGGCTAGCTAGTGCTGCAGGCAGACGTCGATCTGGACGACGCCGCCGGTGGCGAGGCTGTAGTCGTAGTTCTTGGTGACCATGT[A/C,G]
CCCGCGCGCGAGCCGAAACCGCCCCGTGCCGCCGATCACCACCGACTCGCGCTCCCCGGCGTCCATGTCGATGCGGCCCTTCGCCGTCACCGAGCTGCCG

Allele Frequencies:

Search:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	51.20%	0.40%	1.74%	46.61%	NA
All Indica	2759	35.00%	0.50%	2.32%	62.23%	NA
All Japonica	1512	83.30%	0.30%	0.86%	15.48%	NA
Aus	269	19.70%	0.00%	1.49%	78.81%	NA
Indica I	595	40.20%	0.30%	3.03%	56.47%	NA
Indica II	465	28.40%	0.00%	2.37%	69.25%	NA
Indica III	913	32.10%	0.20%	1.53%	66.16%	NA
Indica Intermediate	786	38.30%	1.10%	2.67%	57.89%	NA
Temperate Japonica	767	73.70%	0.00%	1.30%	25.03%	NA
Tropical Japonica	504	95.40%	1.00%	0.20%	3.37%	NA
Japonica Intermediate	241	88.80%	0.00%	0.83%	10.37%	NA
VI/Aromatic	96	88.50%	0.00%	1.04%	10.42%	NA
Intermediate	90	65.60%	1.10%	0.00%	33.33%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1105974446	T -> DEL	LOC_Os11g10840.1	N	frameshift_variant	Average:33.73; most accessible tissue: Callus, score: 75.127	N	N	N	N
vg1105974446	T -> G	LOC_Os11g10840.1	missense_variant ; p.Tyr43Asp; MODERATE	N	Average:33.73; most accessible tissue: Callus, score: 75.127	N	N	N	N
vg1105974446	T -> G	LOC_Os11g10830.1	upstream_gene_variant ; 1608.0bp to feature; MODIFIER	N	Average:33.73; most accessible tissue: Callus, score: 75.127	N	N	N	N
vg1105974446	T -> G	LOC_Os11g10850.1	upstream_gene_variant ; 3971.0bp to feature; MODIFIER	N	Average:33.73; most accessible tissue: Callus, score: 75.127	N	N	N	N
vg1105974446	T -> G	LOC_Os11g10820.1	downstream_gene_variant ; 4865.0bp to feature; MODIFIER	N	Average:33.73; most accessible tissue: Callus, score: 75.127	N	N	N	N
vg1105974446	T -> C	LOC_Os11g10840.1	missense_variant ; p.Tyr43His; MODERATE	nonsynonymous_codon ; Y43H	Average:33.73; most accessible tissue: Callus, score: 75.127	probably damaging	2.234	DELETERIOUS	0.00

Showing 1 to 6 of 6 entries

Contact

Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China

Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/

Search for Variation information by Variation ID:

Detailed information for vg1105974446:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact