RiceVarMap2

Detailed information for vg1105974351:

Variant ID: vg1105974351 (JBrowse)

Variation Type: SNP

Chromosome: chr11

Position: 5974351

Reference Allele: G

Alternative Allele: T

Primary Allele: G

Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, T: 0.05, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:

TGATAGCCACCCATTTTATTATTGCCGAAATCTTTTTTCGACAGCGTGGTGTCGGACCTGAGCCTGCACATGGTGCTGGAGGCCGGCGAGCACCGCGGCA[G/T]
CTCGGTGACGGCGAAGGGCCGCATCGACATGGACGCCGGGGAGCGCGAGTCGGTGGTGATCGGCGGCACGGGGCGGTTTCGGCTCGCGCGCGGGTACATG

Reverse complement sequence

CATGTACCCGCGCGCGAGCCGAAACCGCCCCGTGCCGCCGATCACCACCGACTCGCGCTCCCCGGCGTCCATGTCGATGCGGCCCTTCGCCGTCACCGAG[C/A]
TGCCGCGGTGCTCGCCGGCCTCCAGCACCATGTGCAGGCTCAGGTCCGACACCACGCTGTCGAAAAAAGATTTCGGCAATAATAAAATGGGTGGCTATCA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	95.20%	4.30%	0.15%	0.34%	NA
All Indica	2759	96.00%	3.60%	0.18%	0.25%	NA
All Japonica	1512	92.70%	6.60%	0.07%	0.60%	NA
Aus	269	99.60%	0.00%	0.37%	0.00%	NA
Indica I	595	99.00%	0.20%	0.34%	0.50%	NA
Indica II	465	97.40%	2.20%	0.00%	0.43%	NA
Indica III	913	93.90%	5.80%	0.22%	0.11%	NA
Indica Intermediate	786	95.30%	4.50%	0.13%	0.13%	NA
Temperate Japonica	767	96.60%	2.10%	0.13%	1.17%	NA
Tropical Japonica	504	86.70%	13.30%	0.00%	0.00%	NA
Japonica Intermediate	241	92.90%	7.10%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	95.60%	4.40%	0.00%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1105974351	G -> T	LOC_Os11g10840.1	missense_variant ; p.Ser11Ile; MODERATE	nonsynonymous_codon ; S11I	Average:20.775; most accessible tissue: Callus, score: 34.526	possibly damaging	1.948	DELETERIOUS	0.02
vg1105974351	G -> DEL	LOC_Os11g10840.1	N	frameshift_variant	Average:20.775; most accessible tissue: Callus, score: 34.526	N	N	N	N

Showing 1 to 2 of 2 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1105974351	NA	4.10E-06	mr1236	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105974351	NA	1.57E-10	mr1248	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105974351	NA	4.59E-06	mr1522_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 3 of 3 entries

Previous1Next

Contact

Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China

Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/

Search for Variation information by Variation ID:

Detailed information for vg1105974351:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact