Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1105171877:

Variant ID: vg1105171877 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 5171877
Reference Allele: C	Alternative Allele: G
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CAAGAACAGCTCAGGTAACAGTAACACCAGGAGCGAGGGCTGTAAGGGTCAGGACCAAGCTGCCCACATCGCCACCGGCAGCCTCCCCCCGGCCACCGGA[C/G]
ACCGACCAGAGAGTGGAACGCGCGGCGCCCGCGTTGCAAGGATACGGATACGCCAATGGCGCGGCGCGACGCTGGAGAGGAGAAGCGCGACACGAGCGCG

Reverse complement sequence

CGCGCTCGTGTCGCGCTTCTCCTCTCCAGCGTCGCGCCGCGCCATTGGCGTATCCGTATCCTTGCAACGCGGGCGCCGCGCGTTCCACTCTCTGGTCGGT[G/C]
TCCGGTGGCCGGGGGGAGGCTGCCGGTGGCGATGTGGGCAGCTTGGTCCTGACCCTTACAGCCCTCGCTCCTGGTGTTACTGTTACCTGAGCTGTTCTTG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	84.10%	9.60%	0.06%	6.24%	NA
All Indica	2759	92.20%	0.50%	0.07%	7.18%	NA
All Japonica	1512	72.20%	27.70%	0.07%	0.00%	NA
Aus	269	65.10%	0.70%	0.00%	34.20%	NA
Indica I	595	72.60%	1.70%	0.17%	25.55%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	99.00%	0.00%	0.00%	0.99%	NA
Indica Intermediate	786	94.70%	0.50%	0.13%	4.71%	NA
Temperate Japonica	767	66.80%	33.10%	0.13%	0.00%	NA
Tropical Japonica	504	85.90%	14.10%	0.00%	0.00%	NA
Japonica Intermediate	241	61.00%	39.00%	0.00%	0.00%	NA
VI/Aromatic	96	95.80%	4.20%	0.00%	0.00%	NA
Intermediate	90	81.10%	13.30%	0.00%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1105171877	C -> DEL	LOC_Os11g09684.1	N	frameshift_variant	Average:91.411; most accessible tissue: Minghui63 flag leaf, score: 98.105	N	N	N	N
vg1105171877	C -> G	LOC_Os11g09684.1	missense_variant ; p.Asp113Glu; MODERATE	nonsynonymous_codon ; D113E	Average:91.411; most accessible tissue: Minghui63 flag leaf, score: 98.105	unknown	unknown	DELETERIOUS	0.00

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1105171877	C	G	0.0	0.01	0.04	-0.02	-0.01	0.0