Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1102343860:

Variant ID: vg1102343860 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 2343860
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.96, C: 0.04, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


AATAATGGAACCTAAGGTACATCTATCACAGCTATCTGCGTGTGTAGATGGATGGATGGATACCTGAAAGTACTTGGAACAATGATGCAATGGTTGATGC[C/T]
ATGGCGGATGGATGCTTGATGGACAGTTGATGTCGTCATCATCACGCCGCCGCCGCCGGTGCCGCCGGTGGTGCAGGCTTGGAGGCGACGACGGGGAAGT

Reverse complement sequence

ACTTCCCCGTCGTCGCCTCCAAGCCTGCACCACCGGCGGCACCGGCGGCGGCGGCGTGATGATGACGACATCAACTGTCCATCAAGCATCCATCCGCCAT[G/A]
GCATCAACCATTGCATCATTGTTCCAAGTACTTTCAGGTATCCATCCATCCATCTACACACGCAGATAGCTGTGATAGATGTACCTTAGGTTCCATTATT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.30% 35.70% 0.02% 0.00% NA
All Indica  2759 96.00% 4.00% 0.00% 0.00% NA
All Japonica  1512 2.40% 97.60% 0.00% 0.00% NA
Aus  269 90.70% 9.30% 0.00% 0.00% NA
Indica I  595 97.80% 2.20% 0.00% 0.00% NA
Indica II  465 97.60% 2.40% 0.00% 0.00% NA
Indica III  913 98.60% 1.40% 0.00% 0.00% NA
Indica Intermediate  786 90.60% 9.40% 0.00% 0.00% NA
Temperate Japonica  767 1.30% 98.70% 0.00% 0.00% NA
Tropical Japonica  504 2.80% 97.20% 0.00% 0.00% NA
Japonica Intermediate  241 5.40% 94.60% 0.00% 0.00% NA
VI/Aromatic  96 72.90% 27.10% 0.00% 0.00% NA
Intermediate  90 43.30% 55.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1102343860 C -> T LOC_Os11g05290.1 3_prime_UTR_variant ; 42.0bp to feature; MODIFIER silent_mutation Average:79.691; most accessible tissue: Zhenshan97 panicle, score: 88.625 N N N N
vg1102343860 C -> T LOC_Os11g05280.1 downstream_gene_variant ; 3098.0bp to feature; MODIFIER silent_mutation Average:79.691; most accessible tissue: Zhenshan97 panicle, score: 88.625 N N N N
vg1102343860 C -> T LOC_Os11g05300.1 downstream_gene_variant ; 1651.0bp to feature; MODIFIER silent_mutation Average:79.691; most accessible tissue: Zhenshan97 panicle, score: 88.625 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1102343860 C T 0.02 0.02 0.01 0.01 0.02 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1102343860 NA 8.98E-26 mr1238 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102343860 NA 6.78E-31 mr1448 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102343860 NA 2.55E-11 mr1751 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102343860 NA 4.95E-09 mr1806 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102343860 NA 3.94E-13 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102343860 NA 1.17E-12 mr1553_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102343860 NA 6.09E-16 mr1767_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102343860 NA 5.88E-11 mr1806_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102343860 NA 5.06E-32 mr1873_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102343860 NA 4.75E-13 mr1904_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102343860 NA 2.16E-21 mr1968_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251