Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1100675514:

Variant ID: vg1100675514 (JBrowse)	Variation Type: INDEL
Chromosome: chr11	Position: 675514
Reference Allele: AG	Alternative Allele: A
Primary Allele: AG	Secondary Allele: A

Inferred Ancestral Allele : AG (evidence from allele frequency in Oryza rufipogon: AG: 1.00, others allele: 0.00, population size: 327. )

Flanking Sequence (100 bp) in Reference Genome:

CGTGTCAAATGTCAATCTTTCTAAAGACCTGTCTTTTAATATGTATGCTTGTGAATTGTATTTTGTATATATGCCATACATAAAAATGATACTGCCATTA[AG/A]
TCATTACTGTTGCAATATTCTATTCACAATGTAAATTATCTACTATTGTTATGGTGTAATATTGGAGACTCTACGAACTCTCACTGTTCTGCAGGGCAGA

Reverse complement sequence

TCTGCCCTGCAGAACAGTGAGAGTTCGTAGAGTCTCCAATATTACACCATAACAATAGTAGATAATTTACATTGTGAATAGAATATTGCAACAGTAATGA[CT/T]
TAATGGCAGTATCATTTTTATGTATGGCATATATACAAAATACAATTCACAAGCATACATATTAAAAGACAGGTCTTTAGAAAGATTGACATTTGACACG

Allele Frequencies:

Populations	Population Size	Frequency of AG(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	99.80%	0.20%	0.00%	0.00%	NA
All Indica	2759	99.90%	0.10%	0.00%	0.00%	NA
All Japonica	1512	100.00%	0.00%	0.00%	0.00%	NA
Aus	269	97.00%	3.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.90%	0.10%	0.00%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	100.00%	0.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1100675514	AG -> A	LOC_Os11g02310.1	3_prime_UTR_variant ; 2307.0bp to feature; MODIFIER	silent_mutation	Average:63.741; most accessible tissue: Callus, score: 75.32	N	N	N	N
vg1100675514	AG -> A	LOC_Os11g02320.1	upstream_gene_variant ; 3814.0bp to feature; MODIFIER	silent_mutation	Average:63.741; most accessible tissue: Callus, score: 75.32	N	N	N	N
vg1100675514	AG -> A	LOC_Os11g02330.1	upstream_gene_variant ; 4519.0bp to feature; MODIFIER	silent_mutation	Average:63.741; most accessible tissue: Callus, score: 75.32	N	N	N	N
vg1100675514	AG -> A	LOC_Os11g02320.2	upstream_gene_variant ; 3814.0bp to feature; MODIFIER	silent_mutation	Average:63.741; most accessible tissue: Callus, score: 75.32	N	N	N	N
vg1100675514	AG -> A	LOC_Os11g02320.3	upstream_gene_variant ; 3814.0bp to feature; MODIFIER	silent_mutation	Average:63.741; most accessible tissue: Callus, score: 75.32	N	N	N	N
vg1100675514	AG -> A	LOC_Os11g02330.2	upstream_gene_variant ; 4519.0bp to feature; MODIFIER	silent_mutation	Average:63.741; most accessible tissue: Callus, score: 75.32	N	N	N	N