Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1100642947:

Variant ID: vg1100642947 (JBrowse)	Variation Type: INDEL
Chromosome: chr11	Position: 642947
Reference Allele: TCGC	Alternative Allele: T
Primary Allele: TCGC	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGGATGCTGCCGGGGTGCGCGCACGCGTTTCACAAGGATTGCGTCGTCAAGTGGCTGCGCAACCGCACAACATGCCCGCTCTGCCGTTCTGACGTCGCCG[TCGC/T]
CGCCGCCGCCGCCGCAGATAACATGGTCTGACGCTATCTCAGATTTCACTAACTATCTCTCACCTCCGTCTTAAAATAAATTAACCTAGAAACAGTAGAA

Reverse complement sequence

TTCTACTGTTTCTAGGTTAATTTATTTTAAGACGGAGGTGAGAGATAGTTAGTGAAATCTGAGATAGCGTCAGACCATGTTATCTGCGGCGGCGGCGGCG[GCGA/A]
CGGCGACGTCAGAACGGCAGAGCGGGCATGTTGTGCGGTTGCGCAGCCACTTGACGACGCAATCCTTGTGAAACGCGTGCGCGCACCCCGGCAGCATCCT

Allele Frequencies:

Populations	Population Size	Frequency of TCGC(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	78.20%	0.10%	14.85%	6.86%	NA
All Indica	2759	69.20%	0.10%	19.46%	11.31%	NA
All Japonica	1512	99.80%	0.00%	0.13%	0.07%	NA
Aus	269	40.10%	0.40%	55.76%	3.72%	NA
Indica I	595	68.90%	0.20%	12.61%	18.32%	NA
Indica II	465	92.00%	0.00%	6.02%	1.94%	NA
Indica III	913	55.00%	0.00%	35.05%	9.97%	NA
Indica Intermediate	786	72.30%	0.10%	14.50%	13.10%	NA
Temperate Japonica	767	99.90%	0.00%	0.00%	0.13%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.00%	0.83%	0.00%	NA
VI/Aromatic	96	94.80%	0.00%	4.17%	1.04%	NA
Intermediate	90	88.90%	1.10%	10.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1100642947	TCGC -> T	LOC_Os11g02260.1	disruptive_inframe_deletion ; p.Ala130del; MODERATE	inframe_variant	Average:90.212; most accessible tissue: Minghui63 young leaf, score: 99.423	N	N	N	N
vg1100642947	TCGC -> DEL	LOC_Os11g02260.1	N	frameshift_variant	Average:90.212; most accessible tissue: Minghui63 young leaf, score: 99.423	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1100642947	TCGC	T	0.34	0.47	0.6	0.07	0.41	0.34