| Variant ID: vg1100141579 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 141579 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.73, T: 0.28, others allele: 0.00, population size: 204. )
GCAGATCCTCTCTCTCCAAGTGATAGAAGCAAAAGATGGTCTTAACTGGCCGCTACATGTCTATGGCTTGGTTGCCACCAGGGATTCTGTAGATCAAAAG[C/T]
GCAACCTTCTTTTCAAGCGCACAAGGGATAATTGTTAACTTCTGACTCCACAGGTTAGATATCTTGTAATTTCCTCTTAACTTTATTGTTTCTCATTTTT
AAAAATGAGAAACAATAAAGTTAAGAGGAAATTACAAGATATCTAACCTGTGGAGTCAGAAGTTAACAATTATCCCTTGTGCGCTTGAAAAGAAGGTTGC[G/A]
CTTTTGATCTACAGAATCCCTGGTGGCAACCAAGCCATAGACATGTAGCGGCCAGTTAAGACCATCTTTTGCTTCTATCACTTGGAGAGAGAGGATCTGC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 55.80% | 43.90% | 0.25% | 0.08% | NA |
| All Indica | 2759 | 86.80% | 12.60% | 0.40% | 0.14% | NA |
| All Japonica | 1512 | 1.50% | 98.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 66.20% | 33.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.60% | 2.00% | 0.34% | 0.00% | NA |
| Indica II | 465 | 53.80% | 45.60% | 0.65% | 0.00% | NA |
| Indica III | 913 | 95.10% | 4.50% | 0.33% | 0.11% | NA |
| Indica Intermediate | 786 | 88.50% | 10.70% | 0.38% | 0.38% | NA |
| Temperate Japonica | 767 | 1.30% | 98.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 1.40% | 98.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 2.50% | 97.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 15.60% | 84.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 28.90% | 70.00% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1100141579 | C -> T | LOC_Os11g01250.1 | upstream_gene_variant ; 1261.0bp to feature; MODIFIER | silent_mutation | Average:56.229; most accessible tissue: Zhenshan97 flower, score: 71.992 | N | N | N | N |
| vg1100141579 | C -> T | LOC_Os11g01240.1 | downstream_gene_variant ; 2620.0bp to feature; MODIFIER | silent_mutation | Average:56.229; most accessible tissue: Zhenshan97 flower, score: 71.992 | N | N | N | N |
| vg1100141579 | C -> T | LOC_Os11g01270.1 | downstream_gene_variant ; 2586.0bp to feature; MODIFIER | silent_mutation | Average:56.229; most accessible tissue: Zhenshan97 flower, score: 71.992 | N | N | N | N |
| vg1100141579 | C -> T | LOC_Os11g01260.1 | intron_variant ; MODIFIER | silent_mutation | Average:56.229; most accessible tissue: Zhenshan97 flower, score: 71.992 | N | N | N | N |
| vg1100141579 | C -> DEL | N | N | silent_mutation | Average:56.229; most accessible tissue: Zhenshan97 flower, score: 71.992 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1100141579 | NA | 6.59E-11 | mr1609 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100141579 | NA | 2.57E-06 | mr1835 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100141579 | NA | 7.18E-10 | mr1889 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100141579 | NA | 1.71E-08 | mr1903 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100141579 | NA | 3.58E-10 | mr1904 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100141579 | NA | 3.29E-14 | mr1907 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100141579 | NA | 3.42E-10 | mr1934 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100141579 | NA | 6.99E-09 | mr1935 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100141579 | NA | 4.39E-13 | mr1889_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100141579 | NA | 1.78E-07 | mr1896_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100141579 | NA | 2.54E-13 | mr1907_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1100141579 | NA | 5.56E-10 | mr1934_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |