Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1021955122:

Variant ID: vg1021955122 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 21955122
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 295. )

Flanking Sequence (100 bp) in Reference Genome:


TTTTTTTTTATCATCTGCAGTTTCCCTATACGGCTATACCATGTCGATGCCTGGTGATGCCCAACCTGAAGGTTCTCACCAATCCGCTTCCTCCGCAAAA[C/T]
CTGCCTTGTCATCGTGCCGGAGGAATAAATCTGAGAACACGTCATTTGTCTCAGATTTGAGAGATCACATCCAGGAGTTTATCCATGCTTCCCCGAATGA

Reverse complement sequence

TCATTCGGGGAAGCATGGATAAACTCCTGGATGTGATCTCTCAAATCTGAGACAAATGACGTGTTCTCAGATTTATTCCTCCGGCACGATGACAAGGCAG[G/A]
TTTTGCGGAGGAAGCGGATTGGTGAGAACCTTCAGGTTGGGCATCACCAGGCATCGACATGGTATAGCCGTATAGGGAAACTGCAGATGATAAAAAAAAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.20% 29.10% 0.15% 0.47% NA
All Indica  2759 49.80% 49.30% 0.22% 0.72% NA
All Japonica  1512 99.70% 0.20% 0.07% 0.00% NA
Aus  269 97.40% 2.60% 0.00% 0.00% NA
Indica I  595 40.00% 59.30% 0.34% 0.34% NA
Indica II  465 84.90% 14.80% 0.00% 0.22% NA
Indica III  913 33.40% 65.60% 0.22% 0.77% NA
Indica Intermediate  786 55.30% 43.10% 0.25% 1.27% NA
Temperate Japonica  767 99.60% 0.30% 0.13% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 90.00% 7.80% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1021955122 C -> T LOC_Os10g40824.1 3_prime_UTR_variant ; 841.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg1021955122 C -> T LOC_Os10g40830.1 3_prime_UTR_variant ; 563.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg1021955122 C -> T LOC_Os10g40820.1 upstream_gene_variant ; 2567.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg1021955122 C -> T LOC_Os10g40840.1 upstream_gene_variant ; 4288.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg1021955122 C -> DEL N N silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1021955122 C T -0.01 0.0 0.02 -0.04 0.0 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1021955122 NA 6.33E-07 mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1021955122 NA 3.72E-06 mr1322_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251