Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000678800:

Variant ID: vg1000678800 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 678800
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 350. )

Flanking Sequence (100 bp) in Reference Genome:


GCTGCTGGACAACGGTGTACACATCAGGACATATGTAGTCGTAGAAATCGTCGGATAACTGGCATCTCGCACCCCGAGTATTAAGGCACAGTACAAGAAC[A/T]
GAGCATACAAGCATGAACCTGTAGCTGTAAGAGTACTCCATCTCTCACAGAAGTTACTGCCCTGCTCTTGTGCTGGTTGCACAGTCCATGTTTTCTTGCC

Reverse complement sequence

GGCAAGAAAACATGGACTGTGCAACCAGCACAAGAGCAGGGCAGTAACTTCTGTGAGAGATGGAGTACTCTTACAGCTACAGGTTCATGCTTGTATGCTC[T/A]
GTTCTTGTACTGTGCCTTAATACTCGGGGTGCGAGATGCCAGTTATCCGACGATTTCTACGACTACATATGTCCTGATGTGTACACCGTTGTCCAGCAGC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.50% 16.50% 0.00% 0.00% NA
All Indica  2759 99.50% 0.50% 0.00% 0.00% NA
All Japonica  1512 51.00% 49.00% 0.00% 0.00% NA
Aus  269 98.10% 1.90% 0.00% 0.00% NA
Indica I  595 99.50% 0.50% 0.00% 0.00% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.40% 0.60% 0.00% 0.00% NA
Temperate Japonica  767 21.10% 78.90% 0.00% 0.00% NA
Tropical Japonica  504 94.40% 5.60% 0.00% 0.00% NA
Japonica Intermediate  241 55.20% 44.80% 0.00% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 81.10% 18.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1000678800 A -> T LOC_Os10g02070.1 synonymous_variant ; p.Ser14Ser; LOW synonymous_codon Average:80.992; most accessible tissue: Minghui63 root, score: 93.695 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1000678800 A T -0.03 0.01 -0.01 -0.04 -0.07 -0.07

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1000678800 4.89E-25 6.50E-47 mr1300 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000678800 8.22E-12 1.36E-16 mr1300 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000678800 6.58E-28 1.74E-68 mr1310 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000678800 1.53E-12 9.11E-20 mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000678800 4.46E-06 NA mr1498 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000678800 4.43E-37 3.74E-84 mr1926 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000678800 2.95E-14 1.89E-23 mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000678800 4.20E-15 4.74E-21 mr1959 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000678800 3.24E-09 1.57E-11 mr1959 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000678800 1.28E-43 9.12E-80 mr1310_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000678800 1.17E-21 8.88E-34 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000678800 1.30E-21 7.88E-33 mr1959_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000678800 3.13E-12 1.81E-19 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251