Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0825762997:

Variant ID: vg0825762997 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 25762997
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TACAACTCCTTCCTCGGCGGCAGCCGCCCGGGAGTCTACCACCCATTCGGCGATGACGTCACAGTCGTCGGCATTGACTTCTTCATTGACCGCGGTCAAC[C/G]
CGACCACTACTACGAGATCGCCGAGCGGATCAACTACGACACCCGCCACTGGCGTGACCCCATCGGGTTCAAGCTGACGGCGACGGTGAGTTGTGCGTAC

Reverse complement sequence

GTACGCACAACTCACCGTCGCCGTCAGCTTGAACCCGATGGGGTCACGCCAGTGGCGGGTGTCGTAGTTGATCCGCTCGGCGATCTCGTAGTAGTGGTCG[G/C]
GTTGACCGCGGTCAATGAAGAAGTCAATGCCGACGACTGTGACGTCATCGCCGAATGGGTGGTAGACTCCCGGGCGGCTGCCGCCGAGGAAGGAGTTGTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 99.90% 0.10% 0.00% 0.00% NA
All Indica  2759 99.80% 0.20% 0.00% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.20% 0.80% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0825762997 C -> G LOC_Os08g40690.1 missense_variant ; p.Pro167Arg; MODERATE N Average:77.558; most accessible tissue: Minghui63 panicle, score: 91.227 N N N N
vg0825762997 C -> G LOC_Os08g40680.1 upstream_gene_variant ; 3048.0bp to feature; MODIFIER N Average:77.558; most accessible tissue: Minghui63 panicle, score: 91.227 N N N N
vg0825762997 C -> G LOC_Os08g40700.1 upstream_gene_variant ; 1976.0bp to feature; MODIFIER N Average:77.558; most accessible tissue: Minghui63 panicle, score: 91.227 N N N N
vg0825762997 C -> G LOC_Os08g40710.1 downstream_gene_variant ; 4552.0bp to feature; MODIFIER N Average:77.558; most accessible tissue: Minghui63 panicle, score: 91.227 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0825762997 C G 0.0 0.04 0.03 -0.01 0.01 -0.02