Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0814909930:

Variant ID: vg0814909930 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 14909930
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGCGTTGCCCATGAACACGAGGTTTGCGGCGGCGACGTCCCGCCCCACGGCTGCGAAGTCGTAGTCGAAGGAGAGCGCCGCCGCGGCGCGGAGGGTGGTG[C/A]
AGCAGAGGAAGAGGTGGAGGAGGACATGGCTGGCCATGTTCATCTGCTTTGCTGGCCACCTTACATTGTTATTGCTGCGGCTACTTAGCGTGGGCGTCGT

Reverse complement sequence

ACGACGCCCACGCTAAGTAGCCGCAGCAATAACAATGTAAGGTGGCCAGCAAAGCAGATGAACATGGCCAGCCATGTCCTCCTCCACCTCTTCCTCTGCT[G/T]
CACCACCCTCCGCGCCGCGGCGGCGCTCTCCTTCGACTACGACTTCGCAGCCGTGGGGCGGGACGTCGCCGCCGCAAACCTCGTGTTCATGGGCAACGCC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	83.50%	16.00%	0.19%	0.36%	NA
All Indica	2759	90.70%	8.60%	0.11%	0.54%	NA
All Japonica	1512	72.40%	27.20%	0.33%	0.00%	NA
Aus	269	99.30%	0.40%	0.00%	0.37%	NA
Indica I	595	97.30%	2.40%	0.00%	0.34%	NA
Indica II	465	95.10%	4.90%	0.00%	0.00%	NA
Indica III	913	83.50%	15.20%	0.22%	1.10%	NA
Indica Intermediate	786	91.60%	7.90%	0.13%	0.38%	NA
Temperate Japonica	767	97.50%	2.50%	0.00%	0.00%	NA
Tropical Japonica	504	43.80%	55.80%	0.40%	0.00%	NA
Japonica Intermediate	241	52.30%	46.50%	1.24%	0.00%	NA
VI/Aromatic	96	12.50%	87.50%	0.00%	0.00%	NA
Intermediate	90	76.70%	21.10%	1.11%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0814909930	C -> A	LOC_Os08g24670.1	missense_variant ; p.Cys13Phe; MODERATE	nonsynonymous_codon ; C13F	Average:88.143; most accessible tissue: Callus, score: 96.669	unknown	unknown	TOLERATED	0.59
vg0814909930	C -> DEL	LOC_Os08g24670.1	N	frameshift_variant	Average:88.143; most accessible tissue: Callus, score: 96.669	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0814909930	C	A	-0.03	-0.04	-0.04	-0.04	-0.04	-0.03

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0814909930	NA	2.03E-07	mr1238	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814909930	NA	9.47E-06	mr1309	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814909930	NA	9.56E-08	mr1746	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814909930	NA	1.06E-08	mr1841	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814909930	2.04E-06	2.04E-06	mr1900	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814909930	NA	2.72E-06	mr1194_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814909930	NA	3.75E-07	mr1238_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814909930	NA	1.56E-06	mr1484_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814909930	NA	1.31E-07	mr1841_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814909930	NA	2.46E-06	mr1900_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251