Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0814909263:

Variant ID: vg0814909263 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 14909263
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.64, G: 0.36, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


GCGTGGAAAACATGGTATACTAGTAAAATATGCTGATGAAAAGCCACATACCTGTACTTGAGTTGAAGGACCAAGAGAGGAGCTGGTGCGACTCGACAAG[T/G]
TCCCCGGTGGCCGCCGAGAATCCCACGGCCGCGTCCTGCGGCAAGCCGGCGGCTCTCAGGTCCACCGCCGCCTCCACGCCGTAGTTCGACCCGTTGGCCG

Reverse complement sequence

CGGCCAACGGGTCGAACTACGGCGTGGAGGCGGCGGTGGACCTGAGAGCCGCCGGCTTGCCGCAGGACGCGGCCGTGGGATTCTCGGCGGCCACCGGGGA[A/C]
CTTGTCGAGTCGCACCAGCTCCTCTCTTGGTCCTTCAACTCAAGTACAGGTATGTGGCTTTTCATCAGCATATTTTACTAGTATACCATGTTTTCCACGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.50% 31.00% 0.13% 0.42% NA
All Indica  2759 85.40% 13.90% 0.11% 0.54% NA
All Japonica  1512 44.00% 55.60% 0.20% 0.13% NA
Aus  269 59.10% 40.50% 0.00% 0.37% NA
Indica I  595 97.00% 2.70% 0.17% 0.17% NA
Indica II  465 91.60% 8.20% 0.22% 0.00% NA
Indica III  913 77.50% 21.40% 0.00% 1.10% NA
Indica Intermediate  786 82.20% 17.20% 0.13% 0.51% NA
Temperate Japonica  767 56.20% 43.80% 0.00% 0.00% NA
Tropical Japonica  504 29.80% 70.00% 0.20% 0.00% NA
Japonica Intermediate  241 35.30% 63.10% 0.83% 0.83% NA
VI/Aromatic  96 6.20% 93.80% 0.00% 0.00% NA
Intermediate  90 53.30% 44.40% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0814909263 T -> G LOC_Os08g24670.1 missense_variant ; p.Glu235Asp; MODERATE nonsynonymous_codon ; E235D Average:81.546; most accessible tissue: Callus, score: 92.846 benign -1.323 TOLERATED 1.00
vg0814909263 T -> DEL LOC_Os08g24670.1 N frameshift_variant Average:81.546; most accessible tissue: Callus, score: 92.846 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0814909263 T G 0.01 0.0 0.0 0.03 0.02 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0814909263 NA 1.21E-06 mr1238 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814909263 NA 5.15E-06 mr1708 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814909263 NA 1.54E-07 mr1841 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814909263 NA 7.81E-07 mr1238_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814909263 NA 1.93E-07 mr1794_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814909263 NA 1.39E-07 mr1841_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0814909263 NA 6.77E-06 mr1900_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251