RiceVarMap2

Detailed information for vg0728866275:

Variant ID: vg0728866275 (JBrowse)

Variation Type: SNP

Chromosome: chr07

Position: 28866275

Reference Allele: G

Alternative Allele: A

Primary Allele: G

Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:

GATGAATCTCCAAATCAGGGAACTAGACGAGCAGCATCTTCGTTTGTTTATGTCAGATAAGTAGCCGATCCTGTTGAAATAAAAGTAGCGAGCATTCAGT[G/A]
ATAACAGTTAAAACAACTGCACTAAGATTTCAATCGTAGCTCCAAATAAGAACCGCATTTCATCAGAAGATAGCAAATAAAGGTTACCAATCATTCCTTG

Reverse complement sequence

CAAGGAATGATTGGTAACCTTTATTTGCTATCTTCTGATGAAATGCGGTTCTTATTTGGAGCTACGATTGAAATCTTAGTGCAGTTGTTTTAACTGTTAT[C/T]
ACTGAATGCTCGCTACTTTTATTTCAACAGGATCGGCTACTTATCTGACATAAACAAACGAAGATGCTGCTCGTCTAGTTCCCTGATTTGGAGATTCATC

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	57.40%	42.10%	0.25%	0.28%	NA
All Indica	2759	31.00%	68.20%	0.29%	0.43%	NA
All Japonica	1512	99.30%	0.70%	0.07%	0.00%	NA
Aus	269	82.50%	17.50%	0.00%	0.00%	NA
Indica I	595	45.00%	54.80%	0.17%	0.00%	NA
Indica II	465	11.80%	86.70%	0.43%	1.08%	NA
Indica III	913	33.40%	66.00%	0.11%	0.44%	NA
Indica Intermediate	786	29.00%	70.10%	0.51%	0.38%	NA
Temperate Japonica	767	99.60%	0.40%	0.00%	0.00%	NA
Tropical Japonica	504	99.20%	0.80%	0.00%	0.00%	NA
Japonica Intermediate	241	98.30%	1.20%	0.41%	0.00%	NA
VI/Aromatic	96	72.90%	27.10%	0.00%	0.00%	NA
Intermediate	90	70.00%	25.60%	3.33%	1.11%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0728866275	G -> DEL	N	N	silent_mutation	Average:63.925; most accessible tissue: Callus, score: 83.517	N	N	N	N
vg0728866275	G -> A	LOC_Os07g48300.1	upstream_gene_variant ; 3068.0bp to feature; MODIFIER	silent_mutation	Average:63.925; most accessible tissue: Callus, score: 83.517	N	N	N	N
vg0728866275	G -> A	LOC_Os07g48310.1	intron_variant ; MODIFIER	silent_mutation	Average:63.925; most accessible tissue: Callus, score: 83.517	N	N	N	N
vg0728866275	G -> A	LOC_Os07g48310.2	intron_variant ; MODIFIER	silent_mutation	Average:63.925; most accessible tissue: Callus, score: 83.517	N	N	N	N

Showing 1 to 4 of 4 entries

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0728866275	NA	4.11E-06	mr1807	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Contact

Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China

Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/

Search for Variation information by Variation ID:

Detailed information for vg0728866275:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact