Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0728252688:

Variant ID: vg0728252688 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 28252688
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.68, A: 0.33, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:

CCTCAATTCAATGATCTCATGAGAGAATGATAATACTTGCATGCGCAGCAACACGGCAACTAAATTACTGTACTCGCTTCAGACTACAACAACTATGCAA[A/T]
GGGTGGACTGTAATTCAAGCAAGGTCGAAGCAAGCAATTACCCACGCGAAGGAATCAGTTAGAGACAACAAGAGTAAACAACACATCAAACATTACTGCC

Reverse complement sequence

GGCAGTAATGTTTGATGTGTTGTTTACTCTTGTTGTCTCTAACTGATTCCTTCGCGTGGGTAATTGCTTGCTTCGACCTTGCTTGAATTACAGTCCACCC[T/A]
TTGCATAGTTGTTGTAGTCTGAAGCGAGTACAGTAATTTAGTTGCCGTGTTGCTGCGCATGCAAGTATTATCATTCTCTCATGAGATCATTGAATTGAGG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.00%	46.30%	0.17%	0.53%	NA
All Indica	2759	43.60%	55.40%	0.25%	0.76%	NA
All Japonica	1512	68.00%	31.90%	0.00%	0.13%	NA
Aus	269	50.60%	49.40%	0.00%	0.00%	NA
Indica I	595	58.50%	41.00%	0.17%	0.34%	NA
Indica II	465	24.50%	74.20%	0.65%	0.65%	NA
Indica III	913	47.60%	51.30%	0.11%	0.99%	NA
Indica Intermediate	786	38.80%	60.10%	0.25%	0.89%	NA
Temperate Japonica	767	96.30%	3.70%	0.00%	0.00%	NA
Tropical Japonica	504	22.60%	77.20%	0.00%	0.20%	NA
Japonica Intermediate	241	72.60%	27.00%	0.00%	0.41%	NA
VI/Aromatic	96	78.10%	20.80%	1.04%	0.00%	NA
Intermediate	90	70.00%	27.80%	0.00%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0728252688	A -> DEL	N	N	silent_mutation	Average:55.953; most accessible tissue: Callus, score: 77.588	N	N	N	N
vg0728252688	A -> T	LOC_Os07g47260.1	downstream_gene_variant ; 2981.0bp to feature; MODIFIER	silent_mutation	Average:55.953; most accessible tissue: Callus, score: 77.588	N	N	N	N
vg0728252688	A -> T	LOC_Os07g47270.1	intron_variant ; MODIFIER	silent_mutation	Average:55.953; most accessible tissue: Callus, score: 77.588	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0728252688	NA	7.06E-12	Grain_width	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0728252688	NA	6.37E-06	mr1077	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728252688	NA	4.96E-07	mr1124	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728252688	NA	4.62E-07	mr1277	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728252688	NA	9.20E-08	mr1551	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728252688	NA	1.62E-06	mr1671	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728252688	NA	5.00E-13	mr1789	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728252688	NA	5.29E-14	mr1879	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728252688	NA	4.08E-10	mr1304_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728252688	NA	8.36E-08	mr1308_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728252688	NA	3.60E-07	mr1347_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728252688	NA	8.23E-10	mr1361_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728252688	NA	6.27E-08	mr1364_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728252688	NA	2.58E-13	mr1368_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728252688	NA	2.73E-07	mr1401_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728252688	NA	5.19E-15	mr1540_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728252688	NA	1.19E-07	mr1551_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728252688	NA	4.39E-11	mr1584_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728252688	NA	1.62E-06	mr1730_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728252688	NA	1.12E-14	mr1732_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728252688	NA	9.65E-06	mr1853_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728252688	NA	1.47E-06	mr1866_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728252688	NA	1.23E-10	mr1879_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728252688	NA	7.02E-10	mr1942_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251