Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0728252640:

Variant ID: vg0728252640 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 28252640
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTTTGATCGATCTTGACCCATCCAACATGCAAATTTTAACATATTATTCCTCAATTCAATGATCTCATGAGAGAATGATAATACTTGCATGCGCAGCAAC[A/G]
CGGCAACTAAATTACTGTACTCGCTTCAGACTACAACAACTATGCAAAGGGTGGACTGTAATTCAAGCAAGGTCGAAGCAAGCAATTACCCACGCGAAGG

Reverse complement sequence

CCTTCGCGTGGGTAATTGCTTGCTTCGACCTTGCTTGAATTACAGTCCACCCTTTGCATAGTTGTTGTAGTCTGAAGCGAGTACAGTAATTTAGTTGCCG[T/C]
GTTGCTGCGCATGCAAGTATTATCATTCTCTCATGAGATCATTGAATTGAGGAATAATATGTTAAAATTTGCATGTTGGATGGGTCAAGATCGATCAAAC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.90% 2.70% 0.42% 0.00% NA
All Indica  2759 100.00% 0.00% 0.00% 0.00% NA
All Japonica  1512 90.60% 8.10% 1.26% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.90% 0.10% 0.00% 0.00% NA
Temperate Japonica  767 98.00% 0.90% 1.04% 0.00% NA
Tropical Japonica  504 89.30% 9.90% 0.79% 0.00% NA
Japonica Intermediate  241 69.70% 27.40% 2.90% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 96.70% 2.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0728252640 A -> G LOC_Os07g47260.1 downstream_gene_variant ; 2933.0bp to feature; MODIFIER silent_mutation Average:50.187; most accessible tissue: Zhenshan97 root, score: 72.671 N N N N
vg0728252640 A -> G LOC_Os07g47270.1 intron_variant ; MODIFIER silent_mutation Average:50.187; most accessible tissue: Zhenshan97 root, score: 72.671 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0728252640 NA 7.14E-07 mr1114 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728252640 NA 3.86E-08 mr1117 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728252640 NA 1.30E-06 mr1118 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728252640 NA 8.79E-07 mr1496 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728252640 NA 2.85E-06 mr1113_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728252640 NA 1.95E-06 mr1114_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728252640 NA 1.10E-09 mr1117_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728252640 NA 5.40E-08 mr1119_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728252640 NA 3.77E-06 mr1120_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728252640 NA 7.97E-07 mr1240_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728252640 NA 9.23E-07 mr1242_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728252640 NA 2.12E-06 mr1247_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728252640 NA 1.03E-09 mr1496_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728252640 NA 1.87E-06 mr1691_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728252640 NA 2.27E-06 mr1720_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0728252640 NA 1.72E-06 mr1745_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251