Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0725375828:

Variant ID: vg0725375828 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 25375828
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.01, others allele: 0.00, population size: 318. )

Flanking Sequence (100 bp) in Reference Genome:


GCTGGACAGCTCATGCAATAAAACGTTGGAAGCAAGACAAGCCCAGCTTGGCAGTGTGGATCTCAAGCCCGGAGAGCTACCGGCCGAGCTAGGAGCTGCC[T/C]
TTGACGCTACAGTGGACAGCTGTGCTTTCAAGCCTGGCTTTGGGCGCATTTGTCCCATATGCACAGTTGCATAATGCGTGCAAATGTTGTTCATTGTCCT

Reverse complement sequence

AGGACAATGAACAACATTTGCACGCATTATGCAACTGTGCATATGGGACAAATGCGCCCAAAGCCAGGCTTGAAAGCACAGCTGTCCACTGTAGCGTCAA[A/G]
GGCAGCTCCTAGCTCGGCCGGTAGCTCTCCGGGCTTGAGATCCACACTGCCAAGCTGGGCTTGTCTTGCTTCCAACGTTTTATTGCATGAGCTGTCCAGC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.00% 3.00% 0.00% 0.00% NA
All Indica  2759 99.30% 0.70% 0.00% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 56.90% 43.10% 0.00% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.30% 0.70% 0.00% 0.00% NA
Indica Intermediate  786 98.70% 1.30% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 94.40% 5.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0725375828 T -> C LOC_Os07g42400.1 3_prime_UTR_variant ; 422.0bp to feature; MODIFIER silent_mutation Average:80.716; most accessible tissue: Callus, score: 95.025 N N N N
vg0725375828 T -> C LOC_Os07g42400.2 3_prime_UTR_variant ; 865.0bp to feature; MODIFIER silent_mutation Average:80.716; most accessible tissue: Callus, score: 95.025 N N N N
vg0725375828 T -> C LOC_Os07g42395.1 upstream_gene_variant ; 4021.0bp to feature; MODIFIER silent_mutation Average:80.716; most accessible tissue: Callus, score: 95.025 N N N N
vg0725375828 T -> C LOC_Os07g42395.2 upstream_gene_variant ; 3972.0bp to feature; MODIFIER silent_mutation Average:80.716; most accessible tissue: Callus, score: 95.025 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0725375828 T C 0.03 0.03 0.03 0.04 0.02 0.02