Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0725373636:

Variant ID: vg0725373636 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 25373636
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.04, others allele: 0.00, population size: 295. )

Flanking Sequence (100 bp) in Reference Genome:

AGCGTATGAAGGCTATGCAACTCGGTGATGGTGGCGCAATATTGAAATATTTGCAGACAATGCAAATGGAAAATCCTGCTTTCTTTTACACCATGCAGAT[T/C]
GATGAAGACGACAAGCTAACCAACTTCTTTTGGGCTGACCCAAAATCTAGAGAAGACTTCAACTACTTTGGTGATGTCCTCTGTCTAGACACAACTTACA

Reverse complement sequence

TGTAAGTTGTGTCTAGACAGAGGACATCACCAAAGTAGTTGAAGTCTTCTCTAGATTTTGGGTCAGCCCAAAAGAAGTTGGTTAGCTTGTCGTCTTCATC[A/G]
ATCTGCATGGTGTAAAAGAAAGCAGGATTTTCCATTTGCATTGTCTGCAAATATTTCAATATTGCGCCACCATCACCGAGTTGCATAGCCTTCATACGCT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	70.10%	29.80%	0.04%	0.00%	NA
All Indica	2759	95.30%	4.60%	0.04%	0.00%	NA
All Japonica	1512	24.10%	75.90%	0.00%	0.00%	NA
Aus	269	97.40%	2.60%	0.00%	0.00%	NA
Indica I	595	92.30%	7.70%	0.00%	0.00%	NA
Indica II	465	94.00%	6.00%	0.00%	0.00%	NA
Indica III	913	98.80%	1.20%	0.00%	0.00%	NA
Indica Intermediate	786	94.40%	5.50%	0.13%	0.00%	NA
Temperate Japonica	767	3.90%	96.10%	0.00%	0.00%	NA
Tropical Japonica	504	58.10%	41.90%	0.00%	0.00%	NA
Japonica Intermediate	241	17.40%	82.60%	0.00%	0.00%	NA
VI/Aromatic	96	6.20%	93.80%	0.00%	0.00%	NA
Intermediate	90	56.70%	42.20%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0725373636	T -> C	LOC_Os07g42400.1	synonymous_variant ; p.Ile319Ile; LOW	synonymous_codon	Average:38.747; most accessible tissue: Zhenshan97 young leaf, score: 59.009	N	N	N	N
vg0725373636	T -> C	LOC_Os07g42400.2	synonymous_variant ; p.Ile319Ile; LOW	synonymous_codon	Average:38.747; most accessible tissue: Zhenshan97 young leaf, score: 59.009	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0725373636	NA	9.39E-06	mr1052	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725373636	NA	8.12E-11	mr1055	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725373636	NA	2.05E-10	mr1132	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725373636	NA	1.59E-12	mr1386	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725373636	NA	3.85E-09	mr1563	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725373636	NA	7.09E-08	mr1825	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725373636	NA	1.38E-13	mr1178_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725373636	NA	5.96E-06	mr1498_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725373636	NA	9.95E-14	mr1769_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251