Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0725372962:

Variant ID: vg0725372962 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 25372962
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.71, C: 0.29, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:

AGCTGTCTCTTGGCCATTTTCCTCCTGTTTTGGTGCATTGATGATAATCTAAAATACTAAATGTGTCTATTTCTGTTTATTTACTCAAGTAATAGTATGA[T/C]
TGGTTTTCTAGGGGAAAATGAGACGAATGATAGAAGCTGAACCACCTATAGATGAAGCTGCACTTGCTAAGCTGGTTCCTGAGGTAGGCATGGAATTTGA

Reverse complement sequence

TCAAATTCCATGCCTACCTCAGGAACCAGCTTAGCAAGTGCAGCTTCATCTATAGGTGGTTCAGCTTCTATCATTCGTCTCATTTTCCCCTAGAAAACCA[A/G]
TCATACTATTACTTGAGTAAATAAACAGAAATAGACACATTTAGTATTTTAGATTATCATCAATGCACCAAAACAGGAGGAAAATGGCCAAGAGACAGCT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	61.80%	38.10%	0.06%	0.00%	NA
All Indica	2759	94.90%	5.00%	0.07%	0.00%	NA
All Japonica	1512	0.10%	99.90%	0.00%	0.00%	NA
Aus	269	97.40%	2.60%	0.00%	0.00%	NA
Indica I	595	92.30%	7.70%	0.00%	0.00%	NA
Indica II	465	92.90%	7.10%	0.00%	0.00%	NA
Indica III	913	98.60%	1.40%	0.00%	0.00%	NA
Indica Intermediate	786	93.80%	6.00%	0.25%	0.00%	NA
Temperate Japonica	767	0.10%	99.90%	0.00%	0.00%	NA
Tropical Japonica	504	0.00%	100.00%	0.00%	0.00%	NA
Japonica Intermediate	241	0.40%	99.60%	0.00%	0.00%	NA
VI/Aromatic	96	4.20%	95.80%	0.00%	0.00%	NA
Intermediate	90	38.90%	60.00%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0725372962	T -> C	LOC_Os07g42395.1	upstream_gene_variant ; 1155.0bp to feature; MODIFIER	silent_mutation	Average:58.896; most accessible tissue: Callus, score: 81.46	N	N	N	N
vg0725372962	T -> C	LOC_Os07g42395.2	upstream_gene_variant ; 1106.0bp to feature; MODIFIER	silent_mutation	Average:58.896; most accessible tissue: Callus, score: 81.46	N	N	N	N
vg0725372962	T -> C	LOC_Os07g42400.1	intron_variant ; MODIFIER	silent_mutation	Average:58.896; most accessible tissue: Callus, score: 81.46	N	N	N	N
vg0725372962	T -> C	LOC_Os07g42400.2	intron_variant ; MODIFIER	silent_mutation	Average:58.896; most accessible tissue: Callus, score: 81.46	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0725372962	NA	1.58E-11	mr1070	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725372962	NA	1.51E-13	mr1386	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725372962	NA	5.21E-28	mr1414	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725372962	NA	1.45E-08	mr1514	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725372962	NA	2.00E-35	mr1542	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725372962	NA	2.54E-26	mr1632	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725372962	NA	1.08E-10	mr1683	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725372962	NA	1.64E-11	mr1751	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725372962	NA	3.17E-27	mr1039_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0725372962	NA	2.72E-33	mr1632_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251