Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0725372203:

Variant ID: vg0725372203 (JBrowse)	Variation Type: INDEL
Chromosome: chr07	Position: 25372203
Reference Allele: GT	Alternative Allele: G,GTT,TT,GTTT
Primary Allele: GT	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCAAATCCCGACCAGCCGAAGCATTTCCAACGGAATTCCTCTGTTCGGCTCCTCCTCGGGGTTCAAATCGAGCTTGAATTTGTGGTTTTTTTTGGGGAGG[GT/G,GTT,TT,GTTT]
TTTTTTTTTCTTTTTGGTGTTGTTTTTGGATGCGAGTGTGGCTTGGCAGGGTTGGTGGTGGTGATGCCATGATGCACATGCTGGTGGCCCCCGATGGAGG

Reverse complement sequence

CCTCCATCGGGGGCCACCAGCATGTGCATCATGGCATCACCACCACCAACCCTGCCAAGCCACACTCGCATCCAAAAACAACACCAAAAAGAAAAAAAAA[AC/C,AAC,AA,AAAC]
CCTCCCCAAAAAAAACCACAAATTCAAGCTCGATTTGAACCCCGAGGAGGAGCCGAACAGAGGAATTCCGTTGGAAATGCTTCGGCTGGTCGGGATTTGG

Allele Frequencies:

Populations	Population Size	Frequency of GT(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	77.80%	21.70%	0.25%	0.00%	GTT: 0.15%; GTTT: 0.04%; TT: 0.02%
All Indica	2759	66.90%	32.40%	0.36%	0.00%	GTT: 0.22%; GTTT: 0.07%; TT: 0.04%
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	GTT: 0.07%
Aus	269	57.20%	42.80%	0.00%	0.00%	NA
Indica I	595	74.50%	24.70%	0.67%	0.00%	TT: 0.17%
Indica II	465	90.10%	9.50%	0.00%	0.00%	GTT: 0.43%
Indica III	913	49.50%	49.40%	0.44%	0.00%	GTT: 0.44%; GTTT: 0.22%
Indica Intermediate	786	67.80%	31.90%	0.25%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.00%	0.00%	0.00%	GTT: 0.20%
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	83.30%	14.40%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0725372203	GT -> GTT	LOC_Os07g42400.1	5_prime_UTR_variant ; 20.0bp to feature; MODIFIER	silent_mutation	Average:98.656; most accessible tissue: Zhenshan97 panicle, score: 99.042	N	N	N	N
vg0725372203	GT -> GTT	LOC_Os07g42400.2	5_prime_UTR_variant ; 20.0bp to feature; MODIFIER	silent_mutation	Average:98.656; most accessible tissue: Zhenshan97 panicle, score: 99.042	N	N	N	N
vg0725372203	GT -> GTT	LOC_Os07g42395.1	upstream_gene_variant ; 398.0bp to feature; MODIFIER	silent_mutation	Average:98.656; most accessible tissue: Zhenshan97 panicle, score: 99.042	N	N	N	N
vg0725372203	GT -> GTT	LOC_Os07g42395.2	upstream_gene_variant ; 349.0bp to feature; MODIFIER	silent_mutation	Average:98.656; most accessible tissue: Zhenshan97 panicle, score: 99.042	N	N	N	N
vg0725372203	GT -> GTTT	LOC_Os07g42400.1	5_prime_UTR_variant ; 20.0bp to feature; MODIFIER	silent_mutation	Average:98.656; most accessible tissue: Zhenshan97 panicle, score: 99.042	N	N	N	N
vg0725372203	GT -> GTTT	LOC_Os07g42400.2	5_prime_UTR_variant ; 20.0bp to feature; MODIFIER	silent_mutation	Average:98.656; most accessible tissue: Zhenshan97 panicle, score: 99.042	N	N	N	N
vg0725372203	GT -> GTTT	LOC_Os07g42395.1	upstream_gene_variant ; 398.0bp to feature; MODIFIER	silent_mutation	Average:98.656; most accessible tissue: Zhenshan97 panicle, score: 99.042	N	N	N	N
vg0725372203	GT -> GTTT	LOC_Os07g42395.2	upstream_gene_variant ; 349.0bp to feature; MODIFIER	silent_mutation	Average:98.656; most accessible tissue: Zhenshan97 panicle, score: 99.042	N	N	N	N
vg0725372203	GT -> G	LOC_Os07g42400.1	5_prime_UTR_variant ; 21.0bp to feature; MODIFIER	silent_mutation	Average:98.656; most accessible tissue: Zhenshan97 panicle, score: 99.042	N	N	N	N
vg0725372203	GT -> G	LOC_Os07g42400.2	5_prime_UTR_variant ; 21.0bp to feature; MODIFIER	silent_mutation	Average:98.656; most accessible tissue: Zhenshan97 panicle, score: 99.042	N	N	N	N
vg0725372203	GT -> G	LOC_Os07g42395.1	upstream_gene_variant ; 397.0bp to feature; MODIFIER	silent_mutation	Average:98.656; most accessible tissue: Zhenshan97 panicle, score: 99.042	N	N	N	N
vg0725372203	GT -> G	LOC_Os07g42395.2	upstream_gene_variant ; 348.0bp to feature; MODIFIER	silent_mutation	Average:98.656; most accessible tissue: Zhenshan97 panicle, score: 99.042	N	N	N	N
vg0725372203	GT -> TT	LOC_Os07g42400.1	5_prime_UTR_variant ; 31.0bp to feature; MODIFIER	silent_mutation	Average:98.656; most accessible tissue: Zhenshan97 panicle, score: 99.042	N	N	N	N
vg0725372203	GT -> TT	LOC_Os07g42400.2	5_prime_UTR_variant ; 31.0bp to feature; MODIFIER	silent_mutation	Average:98.656; most accessible tissue: Zhenshan97 panicle, score: 99.042	N	N	N	N
vg0725372203	GT -> TT	LOC_Os07g42395.1	upstream_gene_variant ; 396.0bp to feature; MODIFIER	silent_mutation	Average:98.656; most accessible tissue: Zhenshan97 panicle, score: 99.042	N	N	N	N
vg0725372203	GT -> TT	LOC_Os07g42395.2	upstream_gene_variant ; 347.0bp to feature; MODIFIER	silent_mutation	Average:98.656; most accessible tissue: Zhenshan97 panicle, score: 99.042	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0725372203	GT	G	-0.01	-0.04	-0.01	0.0	0.0	-0.01
vg0725372203	GT	GTT	-0.06	-0.08	-0.08	-0.03	-0.05	-0.04
vg0725372203	GT	GTTT	-0.15	-0.16	-0.14	-0.1	-0.13	-0.16
vg0725372203	GT	TT	-0.01	-0.01	-0.01	-0.01	-0.01	-0.01