RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0724292641:

Variant ID: vg0724292641 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 24292641
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.92, C: 0.09, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:

CAGAAAAAAATGTAGAGATTTTGATCATGAATGATTATATGGCAATGATGTGCGTCATATACATACTTGGCATGACAAAATTGGATGCGTATGTTCGTTT[C/A]
AAAAGATAAGAACATGAATTAGATCTTTTACATGGTTGCTTGTGTTCCTACAAGCTAGGCAGGGCATGGCTTGCAATAGACCAATAGACAATAGTTGATT

Reverse complement sequence

AATCAACTATTGTCTATTGGTCTATTGCAAGCCATGCCCTGCCTAGCTTGTAGGAACACAAGCAACCATGTAAAAGATCTAATTCATGTTCTTATCTTTT[G/T]
AAACGAACATACGCATCCAATTTTGTCATGCCAAGTATGTATATGACGCACATCATTGCCATATAATCATTCATGATCAAAATCTCTACATTTTTTTCTG

Allele Frequencies:

Search:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	56.90%	42.60%	0.11%	0.36%	NA
All Indica	2759	32.00%	67.30%	0.14%	0.47%	NA
All Japonica	1512	98.70%	1.10%	0.00%	0.13%	NA
Aus	269	83.30%	16.70%	0.00%	0.00%	NA
Indica I	595	85.40%	14.50%	0.00%	0.17%	NA
Indica II	465	22.40%	77.00%	0.00%	0.65%	NA
Indica III	913	3.00%	96.50%	0.22%	0.33%	NA
Indica Intermediate	786	31.20%	67.80%	0.25%	0.76%	NA
Temperate Japonica	767	99.50%	0.50%	0.00%	0.00%	NA
Tropical Japonica	504	99.20%	0.80%	0.00%	0.00%	NA
Japonica Intermediate	241	95.40%	3.70%	0.00%	0.83%	NA
VI/Aromatic	96	42.70%	57.30%	0.00%	0.00%	NA
Intermediate	90	54.40%	42.20%	1.11%	2.22%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0724292641	C -> DEL	N	N	silent_mutation	Average:63.582; most accessible tissue: Minghui63 root, score: 82.667	N	N	N	N
vg0724292641	C -> A	LOC_Os07g40550.1	3_prime_UTR_variant ; 708.0bp to feature; MODIFIER	silent_mutation	Average:63.582; most accessible tissue: Minghui63 root, score: 82.667	N	N	N	N
vg0724292641	C -> A	LOC_Os07g40550.2	3_prime_UTR_variant ; 708.0bp to feature; MODIFIER	silent_mutation	Average:63.582; most accessible tissue: Minghui63 root, score: 82.667	N	N	N	N
vg0724292641	C -> A	LOC_Os07g40550.3	3_prime_UTR_variant ; 708.0bp to feature; MODIFIER	silent_mutation	Average:63.582; most accessible tissue: Minghui63 root, score: 82.667	N	N	N	N
vg0724292641	C -> A	LOC_Os07g40540.1	downstream_gene_variant ; 1966.0bp to feature; MODIFIER	silent_mutation	Average:63.582; most accessible tissue: Minghui63 root, score: 82.667	N	N	N	N

Showing 1 to 5 of 5 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0724292641	NA	6.55E-06	mr1125_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0724292641	NA	2.33E-08	mr1170_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 2 of 2 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg0724292641:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact