Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0702848923:

Variant ID: vg0702848923 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 2848923
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 120. )

Flanking Sequence (100 bp) in Reference Genome:

CGCTGAGCAGAAGCCGGTGTTAGCCGTAGTCGTGTGGTCGCCGGCGAGTTCTGGCGAGCACCACAAGTCGACGGTGGAAGAAGACAGTACCGCGTCGGGC[G/A]
AGTGGTGACGTGCAGCAGAATCCAGCGGTGGTCGAAGGTTTTTCCTTGCCGGCGAGTTCTTTTGCGCAACACAGGAGGGTGACGGAAAACTGATGAATGG

Reverse complement sequence

CCATTCATCAGTTTTCCGTCACCCTCCTGTGTTGCGCAAAAGAACTCGCCGGCAAGGAAAAACCTTCGACCACCGCTGGATTCTGCTGCACGTCACCACT[C/T]
GCCCGACGCGGTACTGTCTTCTTCCACCGTCGACTTGTGGTGCTCGCCAGAACTCGCCGGCGACCACACGACTACGGCTAACACCGGCTTCTGCTCAGCG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	77.50%	0.30%	0.66%	21.56%	NA
All Indica	2759	62.70%	0.50%	1.12%	35.70%	NA
All Japonica	1512	98.80%	0.10%	0.00%	1.12%	NA
Aus	269	99.60%	0.00%	0.00%	0.37%	NA
Indica I	595	87.70%	0.70%	0.84%	10.76%	NA
Indica II	465	48.40%	1.10%	1.29%	49.25%	NA
Indica III	913	51.40%	0.10%	1.10%	47.43%	NA
Indica Intermediate	786	65.30%	0.50%	1.27%	32.95%	NA
Temperate Japonica	767	99.20%	0.00%	0.00%	0.78%	NA
Tropical Japonica	504	98.20%	0.20%	0.00%	1.59%	NA
Japonica Intermediate	241	98.80%	0.00%	0.00%	1.24%	NA
VI/Aromatic	96	99.00%	0.00%	0.00%	1.04%	NA
Intermediate	90	83.30%	0.00%	0.00%	16.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0702848923	G -> DEL	LOC_Os07g05910.1	N	frameshift_variant	Average:78.659; most accessible tissue: Minghui63 flag leaf, score: 94.399	N	N	N	N
vg0702848923	G -> A	LOC_Os07g05910.1	missense_variant ; p.Glu109Lys; MODERATE	nonsynonymous_codon ; E109K	Average:78.659; most accessible tissue: Minghui63 flag leaf, score: 94.399	unknown	unknown	DELETERIOUS	0.04

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0702848923	G	A	-0.04	-0.03	-0.04	-0.03	-0.04	-0.04