Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0630423186:

Variant ID: vg0630423186 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 30423186
Reference Allele: A	Alternative Allele: T
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.91, A: 0.09, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:

GATTCTTGTTTTTATCCCTCTAACAAACAATGAAAGCTTGATCTAATTCCCACTGGTTCTAGTGCAATGAAGGAAAAGAACGACAGAAAAACACAATTCA[A/T]
TTTTGTTTTTCTTCAAACATTGATTATTATAGGTTTAAAAAACATTTAGTATATCATAGATAGATTGAATGCAATTGAAACCGCGCTAAAAATTTTAACA

Reverse complement sequence

TGTTAAAATTTTTAGCGCGGTTTCAATTGCATTCAATCTATCTATGATATACTAAATGTTTTTTAAACCTATAATAATCAATGTTTGAAGAAAAACAAAA[T/A]
TGAATTGTGTTTTTCTGTCGTTCTTTTCCTTCATTGCACTAGAACCAGTGGGAATTAGATCAAGCTTTCATTGTTTGTTAGAGGGATAAAAACAAGAATC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	79.80%	20.00%	0.13%	0.00%	NA
All Indica	2759	99.20%	0.60%	0.14%	0.00%	NA
All Japonica	1512	40.20%	59.70%	0.07%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	99.20%	0.70%	0.17%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	99.60%	0.30%	0.11%	0.00%	NA
Indica Intermediate	786	98.60%	1.10%	0.25%	0.00%	NA
Temperate Japonica	767	8.10%	91.80%	0.13%	0.00%	NA
Tropical Japonica	504	86.70%	13.30%	0.00%	0.00%	NA
Japonica Intermediate	241	45.20%	54.80%	0.00%	0.00%	NA
VI/Aromatic	96	82.30%	17.70%	0.00%	0.00%	NA
Intermediate	90	88.90%	10.00%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0630423186	A -> T	LOC_Os06g50260.1	upstream_gene_variant ; 1780.0bp to feature; MODIFIER	silent_mutation	Average:42.755; most accessible tissue: Callus, score: 84.044	N	N	N	N
vg0630423186	A -> T	LOC_Os06g50230.1	downstream_gene_variant ; 4341.0bp to feature; MODIFIER	silent_mutation	Average:42.755; most accessible tissue: Callus, score: 84.044	N	N	N	N
vg0630423186	A -> T	LOC_Os06g50240.1	downstream_gene_variant ; 188.0bp to feature; MODIFIER	silent_mutation	Average:42.755; most accessible tissue: Callus, score: 84.044	N	N	N	N
vg0630423186	A -> T	LOC_Os06g50250.1	intron_variant ; MODIFIER	silent_mutation	Average:42.755; most accessible tissue: Callus, score: 84.044	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0630423186	NA	1.55E-07	mr1364	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630423186	NA	4.67E-06	mr1364	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630423186	NA	3.95E-07	mr1443	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630423186	NA	3.40E-07	mr1443	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630423186	NA	3.33E-06	mr1518	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630423186	NA	2.67E-38	mr1533	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630423186	NA	3.06E-07	mr1659	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630423186	NA	1.96E-32	mr1980	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630423186	NA	1.66E-52	mr1261_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630423186	NA	4.75E-40	mr1533_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630423186	NA	1.11E-19	mr1980_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251