Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0628488640:

Variant ID: vg0628488640 (JBrowse)Variation Type: INDEL
Chromosome: chr06Position: 28488640
Reference Allele: TAAlternative Allele: T,TAA
Primary Allele: TASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTTCGCCGAGCTCGGCCACAGGGCGGCGCGGCCGCGGGTGTGGCGCGCCGCGCCGCCCGACGAGGTGCTCTGGTTTCTCCGGCGAGACGCCGATCGGGGA[TA/T,TAA]
AAAAAAAAATACTGACCAAATGGCGCCTCACGAACTGTTTGATTCTGATCTGATCGCCCCTACAGGTTAGTTTAATTTGGGAGATCGATCATGTAGAGGT

Reverse complement sequence

ACCTCTACATGATCGATCTCCCAAATTAAACTAACCTGTAGGGGCGATCAGATCAGAATCAAACAGTTCGTGAGGCGCCATTTGGTCAGTATTTTTTTTT[TA/A,TTA]
TCCCCGATCGGCGTCTCGCCGGAGAAACCAGAGCACCTCGTCGGGCGGCGCGGCGCGCCACACCCGCGGCCGCGCCGCCCTGTGGCCGAGCTCGGCGAAG

Allele Frequencies:

Populations Population SizeFrequency of TA(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.30% 6.80% 0.08% 0.00% TAA: 3.87%
All Indica  2759 94.20% 2.50% 0.00% 0.00% TAA: 3.30%
All Japonica  1512 96.80% 2.40% 0.26% 0.00% TAA: 0.60%
Aus  269 4.80% 75.50% 0.00% 0.00% TAA: 19.70%
Indica I  595 98.30% 0.00% 0.00% 0.00% TAA: 1.68%
Indica II  465 96.80% 1.50% 0.00% 0.00% TAA: 1.72%
Indica III  913 91.20% 5.00% 0.00% 0.00% TAA: 3.72%
Indica Intermediate  786 93.10% 1.90% 0.00% 0.00% TAA: 4.96%
Temperate Japonica  767 99.30% 0.00% 0.52% 0.00% TAA: 0.13%
Tropical Japonica  504 92.50% 6.20% 0.00% 0.00% TAA: 1.39%
Japonica Intermediate  241 97.50% 2.10% 0.00% 0.00% TAA: 0.41%
VI/Aromatic  96 65.60% 6.20% 0.00% 0.00% TAA: 28.12%
Intermediate  90 87.80% 8.90% 0.00% 0.00% TAA: 3.33%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0628488640 TA -> T LOC_Os06g46960.1 frameshift_variant ; p.Asp238fs; HIGH frameshift_variant Average:92.768; most accessible tissue: Zhenshan97 flag leaf, score: 96.833 N N N N
vg0628488640 TA -> TAA LOC_Os06g46960.1 frameshift_variant ; p.Asp238fs; HIGH frameshift_variant Average:92.768; most accessible tissue: Zhenshan97 flag leaf, score: 96.833 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0628488640 TA T -0.01 -0.07 -0.05 -0.07 -0.07 -0.05
vg0628488640 TA TAA 0.05 -0.04 -0.03 -0.02 0.01 0.01