Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0625949415:

Variant ID: vg0625949415 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 25949415
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGCGGTGACCGCGTACTTGAACGACAGCAGCAGCACCCCGTCCGCGTTCAGCCCGCACGCGCCACGGCACATCACCACCAAAACCCAAAACACCACCACC[C/G]
ACCTCCCCTCCATCGCCGCCGCCGCCGCTGTTACCTCTACTCAGCCGTCGTCGCCGGCGACATGAAGGAACCGAGGCGAGTTGACAATGGAGAGGGAGGA

Reverse complement sequence

TCCTCCCTCTCCATTGTCAACTCGCCTCGGTTCCTTCATGTCGCCGGCGACGACGGCTGAGTAGAGGTAACAGCGGCGGCGGCGGCGATGGAGGGGAGGT[G/C]
GGTGGTGGTGTTTTGGGTTTTGGTGGTGATGTGCCGTGGCGCGTGCGGGCTGAACGCGGACGGGGTGCTGCTGCTGTCGTTCAAGTACGCGGTCACCGCC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.40% 2.60% 0.00% 0.00% NA
All Indica  2759 99.50% 0.50% 0.00% 0.00% NA
All Japonica  1512 98.20% 1.80% 0.00% 0.00% NA
Aus  269 71.70% 28.30% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 98.30% 1.70% 0.00% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 95.20% 4.80% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 95.60% 4.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0625949415 C -> G LOC_Os06g43170.1 missense_variant ; p.Trp5Ser; MODERATE nonsynonymous_codon ; W5S Average:93.742; most accessible tissue: Zhenshan97 panicle, score: 99.042 unknown unknown TOLERATED 0.07

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0625949415 C G -0.01 -0.01 0.0 0.0 0.0 0.0