Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0620000187:

Variant ID: vg0620000187 (JBrowse)Variation Type: INDEL
Chromosome: chr06Position: 20000187
Reference Allele: GAlternative Allele: GGCA
Primary Allele: GSecondary Allele: GGCA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATCGTCGGCATCGTCGTCCTGGCCGTCATCTTCTACACCCGTTCGTCCGCCCGTCACGCCGCCCCCGGCGCGGCGCCCGACGCGGTCACCGCGCTCCAGG[G/GGCA]
GCAGCAGCAGCAGCGCGGCCTCGGCCTCGGCCCCGACGACGTCTCCGTGCTCCCGACGTTCACGTACCACGCCGCCGCCACCGCCTCGCCCGGCCGATGC

Reverse complement sequence

GCATCGGCCGGGCGAGGCGGTGGCGGCGGCGTGGTACGTGAACGTCGGGAGCACGGAGACGTCGTCGGGGCCGAGGCCGAGGCCGCGCTGCTGCTGCTGC[C/TGCC]
CCTGGAGCGCGGTGACCGCGTCGGGCGCCGCGCCGGGGGCGGCGTGACGGGCGGACGAACGGGTGTAGAAGATGACGGCCAGGACGACGATGCCGACGAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of GGCA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.40% 0.30% 4.59% 4.66% NA
All Indica  2759 86.70% 0.00% 6.34% 7.00% NA
All Japonica  1512 97.00% 0.10% 1.19% 1.72% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 81.50% 0.00% 12.61% 5.88% NA
Indica II  465 80.40% 0.00% 9.03% 10.54% NA
Indica III  913 93.40% 0.00% 1.31% 5.26% NA
Indica Intermediate  786 86.40% 0.00% 5.85% 7.76% NA
Temperate Japonica  767 94.80% 0.00% 1.96% 3.26% NA
Tropical Japonica  504 99.80% 0.00% 0.20% 0.00% NA
Japonica Intermediate  241 98.30% 0.40% 0.83% 0.41% NA
VI/Aromatic  96 67.70% 11.50% 20.83% 0.00% NA
Intermediate  90 91.10% 3.30% 4.44% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0620000187 G -> GGCA LOC_Os06g34360.1 disruptive_inframe_insertion ; p.Gln58dup; MODERATE inframe_variant Average:86.707; most accessible tissue: Zhenshan97 flower, score: 95.668 N N N N
vg0620000187 G -> DEL LOC_Os06g34360.1 N frameshift_variant Average:86.707; most accessible tissue: Zhenshan97 flower, score: 95.668 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0620000187 G GGCA -0.11 0.01 -0.04 -0.02 -0.05 -0.1