Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0620000034:

Variant ID: vg0620000034 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 20000034
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CACGTCCCCTGCGTGCCACATCGCGGCCGCTCTCCGCCGGCGCCGACGCGACGTCTCTGACTCCGAGGCACGCCGCCGGCCATCGATCAGGCCATGCCCG[G/A]
CGACTCGGCGTCGTCGACGCTGCAGTACACGGGCATCGGCGCATTCGTCGCCATCGTCGGCATCGTCGTCCTGGCCGTCATCTTCTACACCCGTTCGTCC

Reverse complement sequence

GGACGAACGGGTGTAGAAGATGACGGCCAGGACGACGATGCCGACGATGGCGACGAATGCGCCGATGCCCGTGTACTGCAGCGTCGACGACGCCGAGTCG[C/T]
CGGGCATGGCCTGATCGATGGCCGGCGGCGTGCCTCGGAGTCAGAGACGTCGCGTCGGCGCCGGCGGAGAGCGGCCGCGATGTGGCACGCAGGGGACGTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.50% 9.00% 5.10% 4.34% NA
All Indica  2759 81.50% 3.00% 8.30% 7.18% NA
All Japonica  1512 97.90% 1.30% 0.40% 0.33% NA
Aus  269 1.10% 98.90% 0.00% 0.00% NA
Indica I  595 76.50% 0.00% 16.47% 7.06% NA
Indica II  465 74.20% 2.60% 12.26% 10.97% NA
Indica III  913 89.90% 2.30% 3.18% 4.60% NA
Indica Intermediate  786 79.90% 6.40% 5.73% 8.02% NA
Temperate Japonica  767 99.00% 0.00% 0.65% 0.39% NA
Tropical Japonica  504 95.80% 4.00% 0.00% 0.20% NA
Japonica Intermediate  241 99.20% 0.00% 0.41% 0.41% NA
VI/Aromatic  96 47.90% 52.10% 0.00% 0.00% NA
Intermediate  90 83.30% 7.80% 6.67% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0620000034 G -> A LOC_Os06g34360.1 missense_variant ; p.Gly3Asp; MODERATE nonsynonymous_codon ; G3D Average:87.373; most accessible tissue: Zhenshan97 flower, score: 96.227 unknown unknown TOLERATED 0.18
vg0620000034 G -> DEL LOC_Os06g34360.1 N frameshift_variant Average:87.373; most accessible tissue: Zhenshan97 flower, score: 96.227 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0620000034 G A -0.02 -0.02 -0.03 -0.02 -0.03 -0.04