| Variant ID: vg0609018033 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 9018033 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
GTTAAGGCAGGTTCGTGTGGGTTCACGACCTTGATAAATAATATTGTTTAGTTTTAGAATCGCGTTTACAAAATGGCTTTGAGCAACTAATGTCTTTAAA[T/C]
GCTGTTTACTGCAATCCTAACCCTTTATAGTGTAACTCCTTTGTACTCCCTTGCATTTATTCTGCACTTGTGGGTGTGCCTTGTTGAGTACGGTGGTTGT
ACAACCACCGTACTCAACAAGGCACACCCACAAGTGCAGAATAAATGCAAGGGAGTACAAAGGAGTTACACTATAAAGGGTTAGGATTGCAGTAAACAGC[A/G]
TTTAAAGACATTAGTTGCTCAAAGCCATTTTGTAAACGCGATTCTAAAACTAAACAATATTATTTATCAAGGTCGTGAACCCACACGAACCTGCCTTAAC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 49.70% | 0.30% | 2.62% | 47.42% | NA |
| All Indica | 2759 | 59.70% | 0.10% | 1.49% | 38.78% | NA |
| All Japonica | 1512 | 41.60% | 0.60% | 2.45% | 55.36% | NA |
| Aus | 269 | 7.40% | 0.00% | 13.75% | 78.81% | NA |
| Indica I | 595 | 57.80% | 0.00% | 0.00% | 42.18% | NA |
| Indica II | 465 | 78.90% | 0.00% | 0.43% | 20.65% | NA |
| Indica III | 913 | 45.30% | 0.10% | 4.05% | 50.49% | NA |
| Indica Intermediate | 786 | 66.30% | 0.10% | 0.25% | 33.33% | NA |
| Temperate Japonica | 767 | 74.30% | 0.10% | 0.39% | 25.16% | NA |
| Tropical Japonica | 504 | 6.30% | 1.20% | 4.56% | 87.90% | NA |
| Japonica Intermediate | 241 | 11.20% | 0.80% | 4.56% | 83.40% | NA |
| VI/Aromatic | 96 | 3.10% | 1.00% | 8.33% | 87.50% | NA |
| Intermediate | 90 | 54.40% | 2.20% | 1.11% | 42.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0609018033 | T -> C | LOC_Os06g15870.1 | upstream_gene_variant ; 3418.0bp to feature; MODIFIER | silent_mutation | Average:31.574; most accessible tissue: Zhenshan97 flag leaf, score: 79.006 | N | N | N | N |
| vg0609018033 | T -> C | LOC_Os06g15900.1 | upstream_gene_variant ; 3381.0bp to feature; MODIFIER | silent_mutation | Average:31.574; most accessible tissue: Zhenshan97 flag leaf, score: 79.006 | N | N | N | N |
| vg0609018033 | T -> C | LOC_Os06g15890.1 | downstream_gene_variant ; 1315.0bp to feature; MODIFIER | silent_mutation | Average:31.574; most accessible tissue: Zhenshan97 flag leaf, score: 79.006 | N | N | N | N |
| vg0609018033 | T -> C | LOC_Os06g15880.1 | intron_variant ; MODIFIER | silent_mutation | Average:31.574; most accessible tissue: Zhenshan97 flag leaf, score: 79.006 | N | N | N | N |
| vg0609018033 | T -> DEL | N | N | silent_mutation | Average:31.574; most accessible tissue: Zhenshan97 flag leaf, score: 79.006 | N | N | N | N |