Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0525044703:

Variant ID: vg0525044703 (JBrowse)Variation Type: INDEL
Chromosome: chr05Position: 25044703
Reference Allele: AAlternative Allele: AAGCTCG
Primary Allele: ASecondary Allele: AAGCTCG

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 115. )

Flanking Sequence (100 bp) in Reference Genome:


CTCCCTTTATTAACGCCTCCATCTCTCGCCCTCCACATCATCCCACTCTCTCTCACCCAACGAATTCCCTCGCAAATCCGTCCAAGTTCATCGACACAAG[A/AAGCTCG]
AGCTCGAGCTCGCTGTGTGTGCTTGCAATGGCGGGGGTGCACACGCACAGGGCGTTCCTGCTCTGCAACTACCTCCTCCTCGGCGCCGCCTCGGGCTGCA

Reverse complement sequence

TGCAGCCCGAGGCGGCGCCGAGGAGGAGGTAGTTGCAGAGCAGGAACGCCCTGTGCGTGTGCACCCCCGCCATTGCAAGCACACACAGCGAGCTCGAGCT[T/CGAGCTT]
CTTGTGTCGATGAACTTGGACGGATTTGCGAGGGAATTCGTTGGGTGAGAGAGAGTGGGATGATGTGGAGGGCGAGAGATGGAGGCGTTAATAAAGGGAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of AAGCTCG(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.80% 29.00% 19.26% 0.00% NA
All Indica  2759 27.00% 42.20% 30.81% 0.00% NA
All Japonica  1512 98.90% 0.90% 0.13% 0.00% NA
Aus  269 24.50% 61.70% 13.75% 0.00% NA
Indica I  595 17.80% 38.50% 43.70% 0.00% NA
Indica II  465 43.40% 27.70% 28.82% 0.00% NA
Indica III  913 24.60% 52.20% 23.11% 0.00% NA
Indica Intermediate  786 27.10% 41.70% 31.17% 0.00% NA
Temperate Japonica  767 99.00% 1.00% 0.00% 0.00% NA
Tropical Japonica  504 98.40% 1.20% 0.40% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 88.50% 7.30% 4.17% 0.00% NA
Intermediate  90 60.00% 21.10% 18.89% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0525044703 A -> AAGCTCG LOC_Os05g43140.1 5_prime_UTR_variant ; 15.0bp to feature; MODIFIER silent_mutation Average:92.5; most accessible tissue: Minghui63 panicle, score: 94.218 N N N N
vg0525044703 A -> AAGCTCG LOC_Os05g43130.1 upstream_gene_variant ; 1211.0bp to feature; MODIFIER silent_mutation Average:92.5; most accessible tissue: Minghui63 panicle, score: 94.218 N N N N
vg0525044703 A -> AAGCTCG LOC_Os05g43150.1 upstream_gene_variant ; 1684.0bp to feature; MODIFIER silent_mutation Average:92.5; most accessible tissue: Minghui63 panicle, score: 94.218 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0525044703 A AAGCT* 0.3 0.45 0.41 0.17 0.27 0.32