RiceVarMap2

Detailed information for vg0430889799:

Variant ID: vg0430889799 (JBrowse)

Variation Type: SNP

Chromosome: chr04

Position: 30889799

Reference Allele: G

Alternative Allele: A

Primary Allele: A

Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 313. )

Flanking Sequence (100 bp) in Reference Genome:

ATACAAGAGACGCAATGCCAAGATCGGAAGATCTAAAATCATATCAACCCATTGAATATATCGGAACCCACCATTCAATTAAGATGAAAAAGTAGCAACC[G/A]
TAAGACTTTAGAATAAGTGGCATAGGAGTGAACCTGCTTAGCTAGGGCCTTTTCTATTGTACCCCAAACTGGAAGTATGAGACCACCCAAGATGTTAACC

Reverse complement sequence

GGTTAACATCTTGGGTGGTCTCATACTTCCAGTTTGGGGTACAATAGAAAAGGCCCTAGCTAAGCAGGTTCACTCCTATGCCACTTATTCTAAAGTCTTA[C/T]
GGTTGCTACTTTTTCATCTTAATTGAATGGTGGGTTCCGATATATTCAATGGGTTGATATGATTTTAGATCTTCCGATCTTGGCATTGCGTCTCTTGTAT

Allele Frequencies:

Search:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	76.50%	23.40%	0.06%	0.00%	NA
All Indica	2759	95.60%	4.40%	0.00%	0.00%	NA
All Japonica	1512	49.90%	50.00%	0.13%	0.00%	NA
Aus	269	25.30%	74.30%	0.37%	0.00%	NA
Indica I	595	98.80%	1.20%	0.00%	0.00%	NA
Indica II	465	94.00%	6.00%	0.00%	0.00%	NA
Indica III	913	97.40%	2.60%	0.00%	0.00%	NA
Indica Intermediate	786	92.00%	8.00%	0.00%	0.00%	NA
Temperate Japonica	767	48.90%	51.10%	0.00%	0.00%	NA
Tropical Japonica	504	39.90%	59.90%	0.20%	0.00%	NA
Japonica Intermediate	241	73.90%	25.70%	0.41%	0.00%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	70.00%	30.00%	0.00%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0430889799	G -> A	LOC_Os04g52020.1	intron_variant ; MODIFIER	silent_mutation	Average:70.295; most accessible tissue: Zhenshan97 flower, score: 85.053	N	N	N	N

Showing 1 to 1 of 1 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0430889799	NA	4.98E-06	mr1405_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430889799	NA	3.69E-12	mr1666_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430889799	NA	1.97E-10	mr1761_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0430889799	NA	4.24E-06	mr1781_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 4 of 4 entries

Previous1Next

Contact

Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China

Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/

Search for Variation information by Variation ID:

Detailed information for vg0430889799:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact