Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0427735691:

Variant ID: vg0427735691 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 27735691
Reference Allele: T	Alternative Allele: A
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.74, A: 0.26, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:

ACCAAGCTAACGCACCATCTCCGCTATCTATAATACTGTCACAGGCAATAGAGTAGTAGTGTACGCATAGAAAATATTCAATAGGTTGTACATTTTCAGA[T/A]
AGAAGACGAGCTATTTGCATTTTATTCATGTAAATTGTATAGCATAATTGAAGTACTTGTGATCTGTAATGCCGTGATAGATAGAGAAAACAAAGTTTTA

Reverse complement sequence

TAAAACTTTGTTTTCTCTATCTATCACGGCATTACAGATCACAAGTACTTCAATTATGCTATACAATTTACATGAATAAAATGCAAATAGCTCGTCTTCT[A/T]
TCTGAAAATGTACAACCTATTGAATATTTTCTATGCGTACACTACTACTCTATTGCCTGTGACAGTATTATAGATAGCGGAGATGGTGCGTTAGCTTGGT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.80%	45.70%	0.11%	0.34%	NA
All Indica	2759	83.70%	15.70%	0.11%	0.47%	NA
All Japonica	1512	0.40%	99.50%	0.07%	0.07%	NA
Aus	269	74.00%	26.00%	0.00%	0.00%	NA
Indica I	595	80.20%	19.00%	0.00%	0.84%	NA
Indica II	465	92.00%	7.50%	0.00%	0.43%	NA
Indica III	913	83.40%	16.40%	0.00%	0.22%	NA
Indica Intermediate	786	81.90%	17.20%	0.38%	0.51%	NA
Temperate Japonica	767	0.30%	99.50%	0.13%	0.13%	NA
Tropical Japonica	504	0.40%	99.60%	0.00%	0.00%	NA
Japonica Intermediate	241	0.80%	99.20%	0.00%	0.00%	NA
VI/Aromatic	96	1.00%	99.00%	0.00%	0.00%	NA
Intermediate	90	31.10%	65.60%	1.11%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0427735691	T -> DEL	N	N	silent_mutation	Average:50.705; most accessible tissue: Callus, score: 93.334	N	N	N	N
vg0427735691	T -> A	LOC_Os04g46780.1	3_prime_UTR_variant ; 138.0bp to feature; MODIFIER	silent_mutation	Average:50.705; most accessible tissue: Callus, score: 93.334	N	N	N	N
vg0427735691	T -> A	LOC_Os04g46780.2	3_prime_UTR_variant ; 1879.0bp to feature; MODIFIER	silent_mutation	Average:50.705; most accessible tissue: Callus, score: 93.334	N	N	N	N
vg0427735691	T -> A	LOC_Os04g46800.1	upstream_gene_variant ; 2533.0bp to feature; MODIFIER	silent_mutation	Average:50.705; most accessible tissue: Callus, score: 93.334	N	N	N	N
vg0427735691	T -> A	LOC_Os04g46810.1	upstream_gene_variant ; 4359.0bp to feature; MODIFIER	silent_mutation	Average:50.705; most accessible tissue: Callus, score: 93.334	N	N	N	N
vg0427735691	T -> A	LOC_Os04g46770.1	downstream_gene_variant ; 4638.0bp to feature; MODIFIER	silent_mutation	Average:50.705; most accessible tissue: Callus, score: 93.334	N	N	N	N
vg0427735691	T -> A	LOC_Os04g46790.1	downstream_gene_variant ; 790.0bp to feature; MODIFIER	silent_mutation	Average:50.705; most accessible tissue: Callus, score: 93.334	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0427735691	NA	3.42E-18	mr1336_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427735691	NA	2.74E-15	mr1579_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427735691	NA	4.75E-08	mr1690_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427735691	NA	2.50E-07	mr1745_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251