Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0427734931:

Variant ID: vg0427734931 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 27734931
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, C: 0.00, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:

TATTGGTAGTTTGGTACAAAGCGAATTATTTTTGAGTGACATAAAACCACCGAATCTGGATATCTTTATTGGATAAATATGTACAAAGGAGCTTTTGACT[C/T]
CAGGAAACTGTTGAATAGCAGCATTGGTTAATCAATGAGGATATGGGATGCATTGGCGTTTGGTGATAGATAGGTGATCTTTTAATGAGCCCTAGTCCTT

Reverse complement sequence

AAGGACTAGGGCTCATTAAAAGATCACCTATCTATCACCAAACGCCAATGCATCCCATATCCTCATTGATTAACCAATGCTGCTATTCAACAGTTTCCTG[G/A]
AGTCAAAAGCTCCTTTGTACATATTTATCCAATAAAGATATCCAGATTCGGTGGTTTTATGTCACTCAAAAATAATTCGCTTTGTACCAAACTACCAATA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	54.00%	45.60%	0.32%	0.04%	NA
All Indica	2759	83.80%	15.70%	0.51%	0.04%	NA
All Japonica	1512	0.50%	99.40%	0.07%	0.00%	NA
Aus	269	74.00%	26.00%	0.00%	0.00%	NA
Indica I	595	80.20%	19.00%	0.84%	0.00%	NA
Indica II	465	92.00%	7.50%	0.22%	0.22%	NA
Indica III	913	83.40%	16.40%	0.22%	0.00%	NA
Indica Intermediate	786	82.20%	17.00%	0.76%	0.00%	NA
Temperate Japonica	767	0.40%	99.50%	0.13%	0.00%	NA
Tropical Japonica	504	0.60%	99.40%	0.00%	0.00%	NA
Japonica Intermediate	241	0.80%	99.20%	0.00%	0.00%	NA
VI/Aromatic	96	1.00%	99.00%	0.00%	0.00%	NA
Intermediate	90	37.80%	61.10%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0427734931	C -> DEL	N	N	silent_mutation	Average:46.082; most accessible tissue: Callus, score: 87.686	N	N	N	N
vg0427734931	C -> T	LOC_Os04g46800.1	upstream_gene_variant ; 3293.0bp to feature; MODIFIER	silent_mutation	Average:46.082; most accessible tissue: Callus, score: 87.686	N	N	N	N
vg0427734931	C -> T	LOC_Os04g46770.1	downstream_gene_variant ; 3878.0bp to feature; MODIFIER	silent_mutation	Average:46.082; most accessible tissue: Callus, score: 87.686	N	N	N	N
vg0427734931	C -> T	LOC_Os04g46790.1	downstream_gene_variant ; 1550.0bp to feature; MODIFIER	silent_mutation	Average:46.082; most accessible tissue: Callus, score: 87.686	N	N	N	N
vg0427734931	C -> T	LOC_Os04g46780.1	intron_variant ; MODIFIER	silent_mutation	Average:46.082; most accessible tissue: Callus, score: 87.686	N	N	N	N
vg0427734931	C -> T	LOC_Os04g46780.2	intron_variant ; MODIFIER	silent_mutation	Average:46.082; most accessible tissue: Callus, score: 87.686	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0427734931	NA	1.69E-39	mr1873	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427734931	NA	2.34E-06	mr1873	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427734931	NA	3.57E-06	mr1329_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427734931	NA	1.22E-18	mr1336_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427734931	NA	5.40E-16	mr1579_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427734931	NA	1.73E-08	mr1690_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427734931	NA	4.00E-07	mr1745_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0427734931	NA	7.21E-32	mr1873_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251